SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13148
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.111
 

Sequence

CDS
ATGGAGTCCACGATCGATCTGTTCGCGGAATTCCTCCGTCTGAGGTACCCGACATTATCGGCCGAATTTTTAGAATTTGAGGCCAATCACGCCGCGAACTCAGAAGCGGTCTCCGTCGCGCCCGCCGCTCCCGTGTCCCCAATACTCGCGAGCAAAGCTCCCGCGTCGATCGCTGCGCTCTCGGTTCCAGCCCTGCGCTCATCCGCAGCACACGTCGCGTCCACGCGTTCATCCGCGGCCTCCATCGCGCCCGCGCCGTCCTGTGCCCCCGAGCGATTGTCCGTGGCTTCCGTCGCGACCGTCAACCCCGCGCCCTCTAAAACGCCCGCCTGCGGGTCGCCCGCGCCCTCCTCTTCATCCTACTCGGAGTCGGACATGGAGGTCGATCTTTCCCCCGCCTCCTCGACTGATGGATTCACAGTAGTCCAAAAAGGTAAGAGGCGCGCTGCGGAAGCCCGAGCTCCCGCGGCCGCCAAAGAGGAGCGCGAACTTCGTGCCGTCATACGTGGCATCCCTAAAGAGTTGGATGCCGAACTCGTCAAGGCCGACCTTCTGGAGCAAGGCCTACCAGTAAATTCAGTGCACCGCATGCACACCGGCCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCCCTCCAGCCTACCCCCGAGGTACAGGAGACTCTACTTAAGCCCGCGCGCCGCGACCCTAAAATCGCGAACTATAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATCTACTACAGAAGAGCCTTGCACTGCATCCCGCTCGTTAACATCGAAGCATCAGTATGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGCTTATCTTCCACCGGATAAGATTGTTCTAAGCAGTGATATTGAGGCGCTGCTCAGCATGGGAAGCTCTGTCATTCTGGCGTGCGACCTAAATTGTAAACACATCAGGTGGAACTCTCACATCACAACCCCTAATGGCAGGCGGCTCGACGCGCTAGTCGATGATCTCGCCTTCGATGTCATCGCTCCGCTAAACCCGACTCACTACCCGCTAAATATCGCGCATCGTCCGGATATACTCGACATAGCGTTATTAAAAAACGTAGCTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTAGTGGATTGGCACATGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCTTCAGGATACGGCTGAAGCCATAGACATCCTAACGTCACACATTACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTTCTTCACCGCTTCGAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCTTCGATCCGCGCCTACGATAGGTATCCTACCGTGGAAAATCGTATTCGAATGCGTGCCTTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGGTGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTTTCAAATCGGATACGGTTGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGTCGACTCGTGGCGTTTGATGATGACGAAAAAGCAGAGCTGCAGGCCGATACATTGCAAACCCAGTGCACGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTGGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCATCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTGGGCAAACTGTATGAGCGTTTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTAGGACTTAACCGACCAAAACCGATCTATACGGGAGCCCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTTTTCAACATGGGCGTACCGGACAGTCTCGTGCTCATCATACGAGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGCCTGGAGTCCCGCAAGGCTCCGTTCTCTCTCCGCTCCTATTTAGTTTATTTATTAACGATATTCCCCGGTCGCCGCCGACCCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAGCTCCAGAGTGCAGCGTTAACCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACTAGGATATCCAACCTGGGCTAGGAAGGTCAAGTACCTGGGAGTCACCCTGGATGCATCTATGACATTCCGCCCGCATATAAAAACAGTTCGCGATCGTGCCGCATTTATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTCGACCTACACGACGACCTGGGCCTCGAATCGATCCGCAAACACATGAAGTCAGTGTCGGAACGTTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCAAGTCACCGTCATCGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACTCTTGCATTAGATACCTTCAGCTCTAACACTAGGAGCAGGCTGAGGAACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAGCCTAA
Protein
MESTIDLFAEFLRLRYPTLSAEFLEFEANHAANSEAVSVAPAAPVSPILASKAPASIAALSVPALRSSAAHVASTRSSAASIAPAPSCAPERLSVASVATVNPAPSKTPACGSPAPSSSSYSESDMEVDLSPASSTDGFTVVQKGKRRAAEARAPAAAKEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEVQETLLKPARRDPKIANYNMVRNDRLTARGGGTVIYYRRALHCIPLVNIEASVCRISLTGHAPIVIASAYLPPDKIVLSSDIEALLSMGSSVILACDLNCKHIRWNSHITTPNGRRLDALVDDLAFDVIAPLNPTHYPLNIAHRPDILDIALLKNVALRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHMLGISLAESDPPSLPFSPDSTPSLQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFELPDDIRELLRAKNASIRAYDRYPTVENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTFKSDTVVTMPPLVGPSGRLVAFDDDEKAELQADTLQTQCTPSIQSADPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPIQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTPGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPILGYPTWARKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKHMKSVSERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRHRPRHVLTDPSDPITLALDTFSSNTRSRLRNPGNRTRRTRQRGRRAA

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005359    JAB63107.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02034467    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    GBBI01004571    JAC14141.1    NEVH01022639    PNF18527.1    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    GEZM01053022    JAV74219.1    NEVH01006736    PNF36716.1    ABLF02024246    GGMS01002992    MBY72195.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    GGFL01004957    MBW69135.1    ABLF02023911    GGFL01005012    MBW69190.1    GFTR01008256    JAW08170.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGMR01003407    MBY16026.1    GFTR01008251    JAW08175.1    RPOV01000134    RPJ78669.1    KK119692    KFM76444.1    GGFJ01001857    MBW50998.1    GFTR01008271    JAW08155.1    GGFJ01001858    MBW50999.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    S59870    AAB26437.2    NEVH01026386    PNF14434.1    NEVH01017470    PNF24199.1    GEZM01084969    JAV60363.1    GFTR01008261    JAW08165.1    GGFJ01001822    MBW50963.1    GGMR01000676    MBY13295.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GFTR01008257    JAW08169.1    NEVH01020940    PNF20481.1    GBBI01003810    JAC14902.1    GGMR01003864    MBY16483.1    GGMR01016905    MBY29524.1    GBGD01000415    JAC88474.1    NEVH01016302    PNF25823.1    AY060438    AAL25477.1    GGMR01000226    MBY12845.1    KU543685    AMS38375.1    GGMR01012443    MBY25062.1    GGMS01017365    MBY86568.1    GFTR01008151    JAW08275.1    GEDC01000337    JAS36961.1    GFTR01008246    JAW08180.1    DNOY01000259    HBE18313.1    GECL01003538    JAP02586.1    NWSH01000032    PCG80496.1    AF456125    AAL57609.1    GFDL01000006    JAV35039.1    GGFL01005121    MBW69299.1    GFXV01000908    MBW12713.1    AY180919    AAN87272.1    AF237761    AAF81411.1    GGMR01006408    MBY19027.1    GFTR01008269    JAW08157.1    GGFL01005122    MBW69300.1    KK119261    KFM75202.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.028518,     Score=92

Ontologies

Topology

Length:
1135
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.84129
Exp number, first 60 AAs:
0.00078
Total prob of N-in:
0.00026
outside
1  -  1135
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
215.027914
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号