SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13129
Annotation
PREDICTED:_uncharacterized_protein_LOC106122315_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 2.555
 

Sequence

CDS
ATGAAATCGAAATTCGTATACAAAGTACCCTACGATGCAGTGCAGCCCTATACCCGGTTCTCTTCGAAGCTACTAAGCAGGCGCACCAAGATTCGGATATACAAGACTGTAGTCAGACCGATCCTATTGGATGGATGCGAAGCATGGACGCTTACACAGAAAGAAGAGGCAAAACTTCTCGTGACGGAGCGAAAGGTATTGAGAAAAATACTAGGACCAGTTCGGAAAGAAGAAGATTTTTGGCACGTCCGGAAAAATAAGGATGTGGAGAGGCTTTTTGGTGAGCCAAATATTCTGGGGGAGATGAAGGCACGGACGCTCGGATGGCTCGGACATGTAGTACGTATGGAACAGGATCGGGCTGTGAAACGGGTGTACACGGGTGTACCGGAGGGACGCCGCCCCGTAGGGAGGCCCAAGTACCGCCGGTGTGACGCTGTGGAAATAAATTTACGGGAGCTCCAAGTGTCGGACTGGCAAGGTGTTGCGCAGCGCCGGGATGAATGGCAAAGTTTATTGTCGGAGGCCAAGACCCACTTCGGGGTCATAGCGCCAGCTCAGTAG
Protein
MKSKFVYKVPYDAVQPYTRFSSKLLSRRTKIRIYKTVVRPILLDGCEAWTLTQKEEAKLLVTERKVLRKILGPVRKEEDFWHVRKNKDVERLFGEPNILGEMKARTLGWLGHVVRMEQDRAVKRVYTGVPEGRRPVGRPKYRRCDAVEINLRELQVSDWQGVAQRRDEWQSLLSEAKTHFGVIAPAQ

Summary

EMBL
PYGN01001144    PSN37211.1    PYGN01000540    PSN44578.1    AJVK01021402    GECU01011157    + More
JAS96549.1    NEVH01026393    PNF14276.1    FJ265555    ADI61823.1    PYGN01000629    PSN43121.1    PYGN01000612    PSN43376.1    PYGN01000510    PSN45119.1    PYGN01000287    PSN49259.1    GECU01035086    JAS72620.1    PYGN01003402    PSN29545.1    PYGN01000010    PSN58017.1    GL440612    EFN65619.1    GL439190    EFN67634.1    PYGN01001312    PSN35775.1    PYGN01000136    PSN53183.1    NEVH01001338    PNF43056.1    PYGN01000191    PSN51624.1    PYGN01000106    PSN54154.1    PYGN01000836    PSN40188.1    GBBI01004263    JAC14449.1    PSN53184.1    PYGN01000535    PSN44642.1    PYGN01000325    PSN48468.1    PYGN01001321    PSN35706.1    PYGN01001861    PSN32465.1    NEVH01026392    PNF14311.1    GBBI01004199    JAC14513.1    PYGN01000118    PSN53750.1    PYGN01006068    PSN29155.1    PYGN01000060    PSN55750.1    PYGN01000047    PSN56294.1    HE799691    CCH14900.1    PYGN01000203    PSN51319.1    PYGN01000451    PSN46127.1    PYGN01000168    PSN52268.1    PYGN01001382    PSN35227.1    PYGN01000070    PSN55417.1    PYGN01000078    PSN55011.1    PYGN01000324    PSN48495.1    NEVH01009381    PNF33250.1    PYGN01000020    PSN57453.1    PYGN01000613    PSN43351.1    NEVH01010582    PNF32229.1    PYGN01000657    PSN42717.1    PYGN01001004    PSN38555.1    PYGN01000219    PSN50892.1    GAKP01022638    GAKP01022636    GAKP01022635    JAC36314.1    PYGN01000313    PSN48686.1    GECU01033590    JAS74116.1    PYGN01000116    PSN53825.1    ABLF02024246    PSN53822.1    KU311054    ALX81665.1    PYGN01000080    PSN54879.1    PYGN01000119    PSN53667.1    PYGN01000512    PSN45072.1    PYGN01000064    PSN55609.1    PYGN01000765    PSN41079.1    PYGN01000625    PSN43196.1    PYGN01000111    PSN53993.1    PYGN01000359    PSN47739.1    GGMR01014652    MBY27271.1    ABLF02023718    GGMR01000126    MBY12745.1    GDHC01021627    JAP97001.1    QOUI01000020    RCK67885.1    ABLF02021840    GGFJ01005240    MBW54381.1    NEVH01011195    PNF31853.1    GGMR01001464    MBY14083.1    ABLF02009215    ABLF02009216    AJVK01002125    GGFK01003183    MBW36504.1    PYGN01000212    PSN51056.1    AJVK01015081    GBBI01004261    JAC14451.1    ABLF02035037    GDAI01000742    JAI16861.1    GGFK01002192    MBW35513.1    GGFK01002196    MBW35517.1    GBHO01011285    JAG32319.1    PYGN01000575    PSN43995.1    AJVK01001578    GGMR01017895    MBY30514.1    PYGN01000015    PSN57778.1    PYGN01000827    PSN40309.1    GBBI01004198    JAC14514.1    GGFK01001798    MBW35119.1    GGFK01003613    MBW36934.1    GGFK01005184    MBW38505.1    PYGN01000218    PSN50922.1    GGFK01001949    MBW35270.1    ABLF02032049    ABLF02032052    ABLF02032054    NEVH01016288    PNF26362.1    PYGN01000092    PSN54474.1    PYGN01001492    PSN34499.1    GBHO01016952    JAG26652.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF17753   Ig_mannosidase
PF02837   Glyco_hydro_2_N
PF17786   Mannosidase_ig
PF00703   Glyco_hydro_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR013783   Ig-like_fold       
IPR017853   Glycoside_hydrolase_SF       
IPR036156   Beta-gal/glucu_dom_sf       
IPR006104   Glyco_hydro_2_N       
IPR006102   Glyco_hydro_2_Ig-like       
IPR041625   Beta-mannosidase_Ig       
IPR008979   Galactose-bd-like_sf       
IPR041447   Mannosidase_ig       
SUPFAM
SSF56219   SSF56219        + More
SSF49303   SSF49303       
SSF51445   SSF51445       
SSF49785   SSF49785       
Gene 3D

Ontologies

Topology

Length:
187
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0025
Exp number, first 60 AAs:
0.00227
Total prob of N-in:
0.14897
outside
1  -  187
 
 

Population Genetic Test Statistics

Pi
262.804177
Theta
168.062174
Tajima's D
1.773113
CLR
0
CSRT
0.84390780460977
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号