SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13111
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.364
 

Sequence

CDS
ATGCCCCGGATCAGCCCTCGGCCTCCCAATCGCCAGGTGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGTCGCTTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGTGGTGGAGGCCCGGCTGTACGGCACATTTCGCGTCGCGCAGAGGGCTTTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGTTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGTCCCGTCGGAAAACGGCGGCGACGCCCCTGCTGAGGTGCCCCACATAACGGGGGCGGAGCTCCATGTGGCCGTGCGTAAAATGTGCGCGAAGGACACTGCGCCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATTCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTTCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTACGGGCTCTCTCGGAAGAAGCCGTCTCCAGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCACTGGAAAGACACGGAGTGCCTCTCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTACACAGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTTGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTACTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATCTGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCATGGTTGGAGGCGTCCGTATCGAGGTCGGGGTGCAGTTGAAGTATCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTGGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCACTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCATGGCACGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MPRISPRPPNRQVYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAVVEARLYGTFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDVPSENGGDAPAEVPHITGAELHVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIMVGGVRIEVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALATDYQWRADLRARGMARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01005948    KMQ91066.1    LBMM01006657    KMQ90417.1    LBMM01007036    KMQ90099.1    LBMM01002052    KMQ95336.1    LBMM01008448    KMQ88867.1    LBMM01007425    KMQ89740.1    LBMM01005733    KMQ91252.1    LBMM01015018    KMQ84954.1    LBMM01002480    KMQ94776.1    LBMM01008422    KMQ88894.1    LBMM01015025    KMQ84953.1    LBMM01006063    KMQ90967.1    LBMM01003988    KMQ92922.1    LBMM01004634    KMQ92224.1    LBMM01004505    KMQ92346.1    LBMM01012412    KMQ86235.1    GGMR01000779    MBY13398.1    LBMM01008278    KMQ89009.1    RSAL01003504    RVE40273.1    LBMM01014122    KMQ85315.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01008682    KMQ88705.1    ABLF02011238    LBMM01005474    KMQ91485.1    GGMR01014195    MBY26814.1    GGMR01015159    MBY27778.1    LBMM01003245    KMQ93755.1    GFXV01002090    MBW13895.1    ABLF02034925    LBMM01005216    KMQ91703.1    LBMM01005465    KMQ91492.1    KMQ94772.1    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    ABLF02041886    LBMM01015285    KMQ84870.1    GGMR01004600    MBY17219.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01011682    MBY24301.1    GGMR01006838    MBY19457.1    GFXV01003903    MBW15708.1    LBMM01013668    KMQ85535.1    GGMR01015354    MBY27973.1    ABLF02041557    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    KU543683    AMS38371.1    LBMM01008445    KMQ88871.1    ABLF02010223    ABLF02011183    ABLF02041884    ABLF02018808    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    ABLF02004854    ABLF02041317    ABLF02005203    ABLF02041316    KQ971309    EEZ99146.1    ABLF02018942    ABLF02041885    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    ABLF02023257    GGFJ01001439    MBW50580.1    QOIP01000014    RLU15074.1    GGFJ01001727    MBW50868.1    GGFJ01001369    MBW50510.1    GALA01001777    JAA93075.1    GAKP01002292    JAC56660.1    KQ972226    KYB24577.1    GGFJ01001370    MBW50511.1    GGFL01001583    MBW65761.1    ABLF02004597    ABLF02041324    GEHC01000964    JAV46681.1    GGFK01005660    MBW38981.1    ABLF02007989    LBMM01008226    KMQ89040.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF00151   Lipase
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D
PDB
6AR3     E-value=4.44696e-05,     Score=115

Ontologies

Topology

Subcellular location
Secreted  
Length:
778
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10587
Exp number, first 60 AAs:
0.01132
Total prob of N-in:
0.00109
outside
1  -  778
 
 

Population Genetic Test Statistics

Pi
155.353167
Theta
2.431346
Tajima's D
1.131821
CLR
34.697077
CSRT
0.741512924353782
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号