SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13057
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 2.444
 

Sequence

CDS
ATGCTGGAGCGGCAGTTCGCTCCGAATGACTCTGTATCCTCAGAGGCCGCATTCCACCAATCGGTGGAGGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGATTTCATCACTCCCAGCGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCACTTCCCTGAAACGGTCGTGTCATACATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTCATTGCCTTGCCCAAGCCCGGCAAGGATAGGAGAAATCCTTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCTCAGCGGTCACTCGACAACGCTGCAATTGGTCCGAGTTATGCATCACTTGGCGGATCAGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGGTTCACAAGTTGTTGCGGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCTCAGGGGAGTGTCCTGGCACCACTCCTCTACGCTCTCTATACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAATCGGCGTTGGCGGCCGCTCGCTATGCGAGATTCCTCCTCCGGCCGGTGTTAGCCTCCGGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGTCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGTAATGCCGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATTTAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTAGAACCCCCTTCTATGGTAAGATAG
Protein
MLERQFAPNDSVSSEAAFHQSVEESVANLLSSPVPPLGDDDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILLRPEQFGFLSGHSTTLQLVRVMHHLADQSNARQYTAAVFLDIEKAFDRVWHAGLVHKLLRNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPLLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHAKSALAAARYARFLLRPVLASGLPVRTKLGIYKTYVRSRITYAAAAWYHLIPQVMRVKLQAQQNLALRTIVGAGRYVSNAVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNLAPLHARPPDGRALPRELLEPPSMVR

Summary

EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02033522    ABLF02055645    + More
GGMR01004661    MBY17280.1    GEZM01074951    JAV64378.1    ABLF02041767    GGMS01017914    MBY87117.1    ABLF02017815    KK117880    KFM71667.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02008463    ABLF02034467    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02023911    NEVH01005938    PNF38077.1    NEVH01003017    PNF40781.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    NEVH01020071    PNF21969.1    NEVH01000280    PNF43672.1    NEVH01023961    PNF17613.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02042518    ABLF02057746    NEVH01010546    PNF32261.1    NEVH01001355    PNF42855.1    NEVH01014858    PNF27387.1    NEVH01007838    PNF34986.1    GGMR01019198    MBY31817.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    NEVH01002716    PNF41415.1    ABLF02029306    ABLF02029314    ABLF02060138    NEVH01019376    PNF22596.1    ABLF02040650    ABLF02040651    ABLF02056776    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    ABLF02014862    ABLF02014866    ABLF02061908    NEVH01021205    PNF19912.1    GALX01005299    JAB63167.1    NEVH01026154    PNF14491.1    NEVH01011985    PNF31054.1    ABLF02003961    ABLF02059872    NWSH01000032    PCG80497.1    GALX01005359    JAB63107.1    GEZM01008457    JAV94772.1    ABLF02028535    ABLF02028545    NEVH01017470    PNF24199.1    JXUM01155316    KQ572171    KXJ68070.1    GGMS01004685    MBY73888.1    NEVH01019080    PNF22876.1    IAAA01035747    LAA09607.1    PCG80496.1    ABLF02050434    ABLF02064867    NEVH01000269    PNF43694.1    GFTR01008038    JAW08388.1    ABLF02066620    GEZM01053022    JAV74219.1    GGMS01012005    MBY81208.1    KQ459259    KPJ02068.1    NEVH01007578    PNF35646.1    NEVH01007393    PNF35987.1    ABLF02017813    NEVH01017542    PNF24034.1    AB018558    BAA76304.1    NEVH01022639    PNF18527.1    GDHC01014349    JAQ04280.1    KQ459265    KPJ02064.1    NEVH01002704    PNF41489.1    NEVH01012089    PNF30491.1    KK113014    KFM59099.1    GGMS01000737    MBY69940.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GGMS01008766    MBY77969.1    NEVH01006721    PNF37225.1    KK115908    KFM66338.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    AB055391    BAB21761.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBBI01004571    JAC14141.1    GBHO01013276    JAG30328.1    NEVH01026386    PNF14434.1    NEVH01005277    PNF39135.1    JXUM01014072    KQ560393    KXJ82651.1    KK119261    KFM75202.1    GBHO01016496    JAG27108.1    ABLF02008933    GFXV01005866    MBW17671.1    JXUM01241784    KQ635293    KXJ62492.1    NEVH01026106    PNF14658.1    NEVH01011193    PNF32021.1    NEVH01006736    PNF36716.1    NEVH01020940    PNF20481.1    KK112269    KFM57234.1    PYGN01000192    PSN51582.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF03184   DDE_1
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
IPR004875   DDE_SF_endonuclease_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=1.96721e-05,     Score=116

Ontologies

Topology

Length:
513
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.08173
Exp number, first 60 AAs:
8e-05
Total prob of N-in:
0.00384
outside
1  -  513
 
 

Population Genetic Test Statistics

Pi
435.560553
Theta
233.187347
Tajima's D
2.829634
CLR
0.405553
CSRT
0.970751462426879
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号