SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13049
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.363 Nuclear   Reliability : 2.035
 

Sequence

CDS
ATGGACGCTGTATTTGCGGAATTTCTCCGGCTTCGCTACCCAAAGCTCACTTCCGAGTTTCAGGCCTTCAAGGCCGATCACACTGCGAGCCCTCTCGTGGACTCCACCGAGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATCGAGCACCGCAGCCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTGGTCACCGTTCCAGCAGCGCGATCATCCGCGGCCTCCGTCGCGCCGTCCAAAACACCTACTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCTCCCGCCTCATCGACGGATGGATTCACCCTGGTGCAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCTCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAGCCCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGAACGAGTTTCCCTGGCCCTTAAGGCCAAAAATATCAATTTTACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCGAACATCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCACACATATACGCTCCAGGAGGAGCGCGAACTCCGTGCCGTTATACGTGGCATCCCTAAAGAGTTGGATGCCGAGCTCGTCAAGGCCGACCTTCTCGAACAAGGCCTACCGGTTAACTCCGTACACCGCATGCACACAGGCCGCGGAAGGGAGCCATATAATATGGTTCTCGTCGCCCTCCAGCCTACCCCGAGGCGTGATCAGGTTTCTGACTTTTTGCGTGACCATCAAATTGATATCTTTTTAGTGCAGGAGACCCTACTTAAGCCTGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCACTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATTAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATAATCTCGCCTTCGATATCGTCGCTCCGCTAATCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTACCGTTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCACGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTGCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGTGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGTATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTCTTTCAGAGGGGAAGCCCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATTTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACGCACATAGACATCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTCGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGGTAACCGTACTCGTCGAACTCGACAAAGAGTTCGCCGTGCAACCTAA
Protein
MDAVFAEFLRLRYPKLTSEFQAFKADHTASPLVDSTELAAPASPVPACKASASSTAASVVPAVPASPILASKTAASSAVVTVPAARSSAASVAPSKTPTRRSPAPASSSSDSDSEMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARATPSPRPVAQNKAQTPPPVILQEKAAWERVSLALKAKNINFTNARNLANGIQIKVRTSDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPRRDQVSDFLRDHQIDIFLVQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDNLAFDIVAPLIPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLTAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDVLPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLVSIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSPTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDILQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLGNRTRRTRQRVRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01006359    MBY75562.1    GBBI01004571    JAC14141.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01006736    PNF36716.1    ABLF02034467    GGMS01002992    MBY72195.1    GFTR01008279    JAW08147.1    NEVH01017470    PNF24199.1    GFTR01008261    JAW08165.1    GGFJ01001858    MBW50999.1    KK119261    KFM75202.1    GGFJ01001857    MBW50998.1    KK119692    KFM76444.1    GFTR01008271    JAW08155.1    GGMR01000676    MBY13295.1    GFTR01008256    JAW08170.1    GGFL01004957    MBW69135.1    GFTR01008251    JAW08175.1    NEVH01016302    PNF25823.1    GGMR01003407    MBY16026.1    GGFL01005012    MBW69190.1    ABLF02023911    NEVH01020940    PNF20481.1    GGMS01017365    MBY86568.1    GBGD01000415    JAC88474.1    GFTR01008257    JAW08169.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    AF237761    AAF81411.1    GGMR01000226    MBY12845.1    GGMR01016905    MBY29524.1    GEZM01084969    JAV60363.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008260    JAW08166.1    GFXV01000908    MBW12713.1    GGFJ01001822    MBW50963.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    AY060438    AAL25477.1    GFTR01008246    JAW08180.1    GGMR01006408    MBY19027.1    NWSH01000032    PCG80496.1    GGMR01012305    MBY24924.1    KU543685    AMS38375.1    KU543673    AMS38352.1    M17214    AAA28508.1    DNOY01000259    HBE18313.1    GFXV01002840    MBW14645.1    GFTR01008269    JAW08157.1    GBGD01000389    JAC88500.1    NEVH01019963    PNF22185.1    AY180919    AAN87272.1    M22874    M38643    GBBI01003747    JAC14965.1    GEDC01000337    JAS36961.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1243
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.60173000000001
Exp number, first 60 AAs:
0.00013
Total prob of N-in:
0.00010
outside
1  -  1243
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.330191
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号