SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12954  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000238
Annotation
PREDICTED:_peroxidase-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.751
 

Sequence

CDS
ATGTCGTTCCTGCCAATAAGCATTCTCATTATATTAGTTGTTAATCTAGCAAAAGCAGTCTATTATGACTCATGGGAAGGTACGCCTCTAACAGACGAGCAAAGACAGGCCTATGAAAATGCTAATATTTTAAGTACATGTGCGAATAATATTCAGCCTTGTGACGAGACCGAATGGAGGCGTACAGATGGTAGCTGCAATAACCTTTATTATCCTACTCGGGGAGCATACCATACACCAACTTTTAGAATCCTGCCCGCCGATTTTCGTGAAGATTTTGAGCCCAGGCTGACCAGTTCAGGGAAGGAGTATCCTCTAGCCAGACATATCAAGAACAATCTATTGACAGTAGGATTGGCTACAGATGCAAAATTAACGCAGTTGTCTGCGTATTACATTGAGTTTATGGCCATTGATGTTGTCTCCGCACATGACATCTTGAATTACATCGTGGATAGGCCTTACTGCTGTAAAGAAGAGGGAAAATCTGATCCTATGTGTGCTCCTAACTTCATACCAGAATTCGACCCGGTTCACCGATTTTCGGGGCACAAGTGCTTTAACATGACAATACCTATGACGTTCCAAAATCTGGGATGCATTGAGAATGGCACGACTCCTAGTCGAATCGATTTCACTACGACATTCTTTGATTTATCTAATATTTACGAGTTTTCTGCTGGTTCTTTAAATCAAGTTAGGTCTTATGAAGGTGGACAGTTGAAATACGAAGTGGTTAATGGCAGACAGTTCCCTAGCGACGCCAGCGATAATACCACTTGTTTCATCAAGCAAGCCATTAGTACAGGGTGCAGTAGAAATGTACCAAATGGAGTATTGGGCAGTAATCTGTTTACAACATGGTTCTGGCGCTTCCATAACTATGTGGCTCAGCAACTAGCAAATCTCAATTCTAGCTGGGATGACGAACGACTCTTTTATACTGCGAGAGATATTGTTGTCGCTTTTCATCTGCAAATGTTCTATTACGAATTTCTGCCCGAAATTTTGGGTAAAGATAACATGATTGAAGATGAAATAATATTAGGTAACTCAACGGGCTTCAGGGACATATACGATGAAACGGTTGTACCTCAAATTGCTCTAGAATACGCGTACGCGAGCAGATGGTTTCATACAATACAATACGGCGCTCAAAAACTTTTTGATAAAAACTTTAATTTCATTAAAGAGGTACCGATGGTGAACTTCTCTCTGAGCGTCCAGTCTTTAGCTGTAGGTGACATTATGTCGACCGTAACACGAGGATCGTATTATCAAGCAACTGGCAAAGCTGATTCCACCGTAGATCCTGATATATCAGATATCGGCTTAGGACCTGTGCAAGAAGTTTTCGATATACCGACAACAGATTTAGCTAAAGGCAGATATTTTGGACTACCTTCTTACACAAAATACAGAGACTTCTGCTCAGGCTATTCAAAAAAACATGTTGATTTCGACGATTTAACGGACCACATTAGTGATGAGAAAATACAACAGCTCAAACAAGTTTATGAGACGGCCGAAGACATAGAACTTATGGCAGGTATTTGGGTAGAGAACGTGATAGAAGGAGCTCAAGTTCCACCAACTGTACACTGTTTGTTATCAAACCAACTTAAAAGAAGTATTATCATTGACAGACATTGGTATGAAAGGCCTAATCGCCCACATGCCTTTAATTATGAACAACTTCAAGAAATTAGGAAAGCTTCTTTAGCGCTTCTGCTATGCTATGTGGGAGATGACGTTGAAAAAATCCAACCCAAGGCTTTCACTATCGTTGGAAAAGGGTTAGCCGTCGTAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGATAGCCGTCGGAGCTCCGTGGTTCGTTAGGAACGTCGATCTCCATGACGACTTGGACTTAGAGTCCATCAGTAGGTATCTTCAGTCGGCGTCAATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCCAAACACGTCATTTCGGATCCTCCCGATCCACCAACGGTGCTTTTAGGGCTCTTCGACGCTACCAAGGCATTTTGTGACATGGGTGTTGTCGAAGCCGTCGCCTTGGATCCTAAATACTTAGAACAATTGAAAGTAAAATCGCAGAATTTAGGGCATGATAATTATGAGTCTCCTACTAGGACACTGCAAGGTGACAGGACGTATTATTTTGAGCCCAGGCTGACTAGTTCAGGGAAGGAGTATCCTCTAGCCAGACATATCAAGAACAATCTATTGACAATAGGATTGGCTACAGATGCAAAATTAACGCAGTTGTCTGCGTATTACATTGAGTTTATGGCCATTGATGTTGTCTCCGCACATGACATCTTGAATTACATCGTGGATAGGCCTTACTGCTGTAAAGAAGAGGGAAAATCTGATCCTATGTGTGCTCCTAACTTCATACCAGAATTCGACCCGGTTCACCGATTTTCGGGGCACAAGTGCTTTAACATGACAATACCTATGACGTTCCAAAATCTGGGATGCATTGAGAATGGCACGACTCCTAGTCGAGTAATACCAAATGGAGTATTGGGCAGTAATCTGTTTACAACATGGTTCTGGCGCTTCCATAACTATGTGGCTCAGCAACTAGCAAATCTCAATCCTAGCTGGGATGACGAACGACTCTTTTATACTGCGAGAGATATTGTTGTCGCTTTTCATCTGCAAATGTTCTATTACGAATTTCTGCCCGAAATTTTGGGTAAAGATCACATGATTGAAGATGAAATAATATTAGGTAACTCAACGGGCTTCAGGGACATATACGATGAAACGGTTGTACCTCAAATTGCTCTAGAGTACGCATATGCGAGCAGATGGTTTCATACAATACAATACGGCGCTCAAAAACTTTTTGATAAAAACTTTAATCTCATTAAAGAGGTACCGATGGTGAACTTCTCTCTGAGCGTCCAGTCTTTAGCTATAGGTGACATAATGTCAACCGTAACACGAGGATCGTATTATCAAGCCACTGGCAAAGCTGATTCCACCGTAGATCCTGATATATCAGATATCGGCTTAGGACCTGTGCAAGAAGTTTTCGATATACCGACAACAGATTTAGCTAAGGGCAGATATTTTGGACTACCTTCTTACACAAAATACAGAGACTTCTGCTCGGGCTATTCAAAAAAACATGTTGATTTCGACGATTTAACGGACCACATTAGTGATGAGAAAATACAACAGCTCAAACAAGTTTATGAGACGGCCGAAGACATAGAACTTATGGCAGGTATTTGGGTAGAGAACGTGATAGAAGGAGCTCAAGTTCCACCAACTGTACACTGTTTGTTATCAAACCAGCTTAAAAGAAGTATTATCATTGACAGACATTGGTATGAAAGGCCTAATCGCCCACATGCCTTTAATCATGAACAACTTCAAGAAATTAGGAAAGCTTCTTTAGCGCTTCTGCTATGCTATGTGGGAGATGACGTTGAAAAAATCCAACCTAAGGCTTTCACTATCGTTGGAAAAGGAAACAATTTGGTCAGCTGTGATGAAATTCCGGCTATAGACTTTACACACTGGAAAGAAGAATCGTAA
Protein
MSFLPISILIILVVNLAKAVYYDSWEGTPLTDEQRQAYENANILSTCANNIQPCDETEWRRTDGSCNNLYYPTRGAYHTPTFRILPADFREDFEPRLTSSGKEYPLARHIKNNLLTVGLATDAKLTQLSAYYIEFMAIDVVSAHDILNYIVDRPYCCKEEGKSDPMCAPNFIPEFDPVHRFSGHKCFNMTIPMTFQNLGCIENGTTPSRIDFTTTFFDLSNIYEFSAGSLNQVRSYEGGQLKYEVVNGRQFPSDASDNTTCFIKQAISTGCSRNVPNGVLGSNLFTTWFWRFHNYVAQQLANLNSSWDDERLFYTARDIVVAFHLQMFYYEFLPEILGKDNMIEDEIILGNSTGFRDIYDETVVPQIALEYAYASRWFHTIQYGAQKLFDKNFNFIKEVPMVNFSLSVQSLAVGDIMSTVTRGSYYQATGKADSTVDPDISDIGLGPVQEVFDIPTTDLAKGRYFGLPSYTKYRDFCSGYSKKHVDFDDLTDHISDEKIQQLKQVYETAEDIELMAGIWVENVIEGAQVPPTVHCLLSNQLKRSIIIDRHWYERPNRPHAFNYEQLQEIRKASLALLLCYVGDDVEKIQPKAFTIVGKGLAVVAPWFVRNVDLHDDLGLESIQKYMKSASERIAVGAPWFVRNVDLHDDLDLESISRYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPPTVLLGLFDATKAFCDMGVVEAVALDPKYLEQLKVKSQNLGHDNYESPTRTLQGDRTYYFEPRLTSSGKEYPLARHIKNNLLTIGLATDAKLTQLSAYYIEFMAIDVVSAHDILNYIVDRPYCCKEEGKSDPMCAPNFIPEFDPVHRFSGHKCFNMTIPMTFQNLGCIENGTTPSRVIPNGVLGSNLFTTWFWRFHNYVAQQLANLNPSWDDERLFYTARDIVVAFHLQMFYYEFLPEILGKDHMIEDEIILGNSTGFRDIYDETVVPQIALEYAYASRWFHTIQYGAQKLFDKNFNLIKEVPMVNFSLSVQSLAIGDIMSTVTRGSYYQATGKADSTVDPDISDIGLGPVQEVFDIPTTDLAKGRYFGLPSYTKYRDFCSGYSKKHVDFDDLTDHISDEKIQQLKQVYETAEDIELMAGIWVENVIEGAQVPPTVHCLLSNQLKRSIIIDRHWYERPNRPHAFNHEQLQEIRKASLALLLCYVGDDVEKIQPKAFTIVGKGNNLVSCDEIPAIDFTHWKEES

Summary

Uniprot
ProteinModelPortal
PDB
3R5Q     E-value=8.95291e-25,     Score=286

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.992693
 
 
Length:
1232
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.578469999999995
Exp number, first 60 AAs:
0.56954
Total prob of N-in:
0.02729
outside
1  -  1232
 
 

Population Genetic Test Statistics

Pi
227.403148
Theta
180.57346
Tajima's D
1.145788
CLR
0.099283
CSRT
0.700414979251037
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27102218 SDPMCAPNFIPEFDPVHR 100.00 2e-10
27102218 SDPMCAPNFIPEFDPVHR 100.00 2e-10
27102218 GNNIVSCDEIPAIDFTHWK 95.45 1e-09
27102218 NNIITIGIATDAK 95.24 2e-09
24093152 EEFSDDEVDCFIPR 95.45 2e-09
24093152 EEFSDDEVDCFIPR 95.45 2e-09
27102218 IFDKNFNIIK 95.24 8e-09
27102218 DSGIIISSSWDSTAK 95.24 8e-09
24093152 SDMWMIFR 100.00 9e-07
24093152 SDMWMIFR 100.00 9e-07
27102218 ITSSGKEYPIAR 100.00 9e-07
27102218 ITSSGKEYPIAR 100.00 9e-07
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号