SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12952  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000238
Annotation
PREDICTED:_peroxidase-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.289
 

Sequence

CDS
ATGCCCAAAAGTGGGCCAACTTTATGTCAAAACTATTTGTACTTGAAAAATACATGTGCGAATAATATTCAGCCTTGTGAAGAGACCGAATGGAGGCGTACAGACGGTAGCTGCAATAACCTTTATTATCCTACCCGGGGAGCATACCATACACCAACTTTCAGAATCCTGCCCGCCGATTTTCGTGAAGATTTTGAGCCCAGGCTGACCAGTTCAGGGAAGGAGTATCCTCTAGCCAGACATATCAAGAACAATCTATTGACAGTAGGATTGGCTACAGATGCAAAATTAACGCAGTTGTCTGCGTATTACATTGAGTTTATGGCCATTGATGTTGTCTCCGCACATGACATCTTGAATTACGTCGTGACTAGGCCTTACTGCTGTAAAGAAGAGGGAAAATCTGATCCTATGTGTGCTCCTAACTTCATACCAGAATTCGACCCGGTTCACCGATTTTCGGGGCACAAGTGCTTTAACATGACAAAACCTATGACGTTCCAAAATCTGGGATGCATTGAGAATGGCACGACTCCTAGTCGAATCGACTTCTCTACGACATTCTTTGATTTATCTAATATTTACGAGTTTTCTGCTGGTTCTTTAAACCAAGTTAGGTCTTATGAAGGTGGACAGTTGAAATACGAAGTGGTTAATGGCAGACAGTTCCCTAGTGACGCCAGCGATAATACCACTTGTTTTATCAAGCAAGCCATTAGTACAGGGTGTACTAGAACTGTACCAAATGGAATATTGGGCACTAATCTGTTTACAACATGGTTCTGGCGCTTCCATAACTATGTGGCTCAGCAACTAGCAAATCTCAATCCTAGCTGGGATGACGAGCAACTCTTTTATACTGCGAGAGATATTGTTGTCGCTTTTCATCTGCAAATGTTCTATTACGAATTTCTGCCCGAAGTTTTGGGTAAAGATCACATGATTGAAGATGAAATAATATTATGTAACTCAACGGGCTTCAGGGACATTTACGATGAAACGGTTGTGCCTCAAATTGCTCTAGAGTACGCATACGCGAGCAGGTGGTTTCATACAATACAATACGGCGCTCAAAAACTTTTTGATAAAAACTTTAATTTCATTAAAGAAGTACCAATGGTGAACTTCACTCTGAGCGTCCAGTCTTTAGCTGTAGGTGACATTATGTCGACCGTAACACGAGGATCGTATTATCAAGCTACTGGCAAAGGTGATTCCAGCGTAGATCCTGATATAACAGATGTCGGCTTAGGACCCGTGCAAGAAATTTTCGATATACCGACAGCAGATTTAGCTAAAGGCAGATATTTTGGACTACCTTCTTACACAAAATACAGAGACTTCTGCTCGGGCTATTCAAAAAAACATGTTGATTTCGACGATTTAACGGACCACATTAGTGATGAGCTCAAACAAGTTTATGAGACGGCCGAAGACATAGAACTTATGGCAGGTATTTGGCTAGAGAATTTGAAAGAAGGAGCTCACGTTCCGCCAACTGTACACTGTTTGTTATCAAACCAGCTTAAAAGAAGTATTATCATTGACAGACATTGGTATGAAAGGCCTAATCGCCCACATGCCTTTAATTATGAACAACTTCAAGAAATTAGGAAAGCTTCTTTAGCGCTTCTGCTATGCTATGTGGGAGATGACGTTGAAAAAATCCAACCCAACCCTTTCGTTATCGTTGGAAAAGGGATAGCCGTCGGAGCTCTGTGGTTCGTCAGGAACGTCGATCTCCATGACGACTTGGACTTAGAGTCCATCAGTAGGTATCTTCAGTCGGCGACGATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTAGCCGCCGGTAACTACATTCCCGATCCTGCGGAGAGAATGGAAAGCAGTCGACGTCGCGCCAAACACGTCATTTCGGATCCTCCCGATCCACCAACGGTGCTTTTAGGAGATATGGGCATAGATAAGGGCATGTTCTACGTTGACATTTAA
Protein
MPKSGPTLCQNYLYLKNTCANNIQPCEETEWRRTDGSCNNLYYPTRGAYHTPTFRILPADFREDFEPRLTSSGKEYPLARHIKNNLLTVGLATDAKLTQLSAYYIEFMAIDVVSAHDILNYVVTRPYCCKEEGKSDPMCAPNFIPEFDPVHRFSGHKCFNMTKPMTFQNLGCIENGTTPSRIDFSTTFFDLSNIYEFSAGSLNQVRSYEGGQLKYEVVNGRQFPSDASDNTTCFIKQAISTGCTRTVPNGILGTNLFTTWFWRFHNYVAQQLANLNPSWDDEQLFYTARDIVVAFHLQMFYYEFLPEVLGKDHMIEDEIILCNSTGFRDIYDETVVPQIALEYAYASRWFHTIQYGAQKLFDKNFNFIKEVPMVNFTLSVQSLAVGDIMSTVTRGSYYQATGKGDSSVDPDITDVGLGPVQEIFDIPTADLAKGRYFGLPSYTKYRDFCSGYSKKHVDFDDLTDHISDELKQVYETAEDIELMAGIWLENLKEGAHVPPTVHCLLSNQLKRSIIIDRHWYERPNRPHAFNYEQLQEIRKASLALLLCYVGDDVEKIQPNPFVIVGKGIAVGALWFVRNVDLHDDLDLESISRYLQSATMRHFDKAARHENPLIVAAGNYIPDPAERMESSRRRAKHVISDPPDPPTVLLGDMGIDKGMFYVDI

Summary

EMBL
BABH01013455    BABH01013458    BABH01013459    BABH01013460    KQ459324    KPJ01645.1    + More
NWSH01006580    PCG63355.1    RSAL01000046    RVE50539.1    KPJ01647.1    AGBW02012596    OWR44740.1    KZ149907    PZC78257.1    KPJ01646.1    AK401278    BAM17900.1    ODYU01007226    SOQ49823.1    ODYU01007479    SOQ50286.1    KQ460416    KPJ14923.1    BABH01034743    BABH01034744    NWSH01002854    PCG67434.1    PZC78258.1    ODYU01007063    SOQ49501.1    KPJ14922.1    KJ995811    AIN39494.1    NWSH01001320    PCG71707.1    ODYU01007325    SOQ50002.1    PZC78259.1    BABH01034746    BABH01034747    ODYU01004596    SOQ44641.1    BABH01028746    BABH01028747    BABH01028748    KQ459564    KPI99614.1    KZ149956    PZC76461.1    NWSH01006414    PCG63451.1    KQ459837    KPJ19761.1    NWSH01001116    PCG72532.1    PCG72533.1    PZC76463.1    PZC76464.1    NWSH01006200    PCG63597.1    RSAL01000083    RVE48485.1    RSAL01000231    RVE43837.1    MH606240    AXM43807.1    KM384736    AIO11227.1    QOIP01000004    RLU23752.1    NEVH01006567    PNF37876.1    KJ995807    AIN39490.1    KQ459896    KPJ19443.1    KK107453    EZA50655.1    RSAL01000011    RVE53586.1    NNAY01001189    OXU24803.1    KQ760645    OAD59676.1    KQ459589    KPI97477.1    ATLV01000829    KE523910    KFB34769.1    ADMH02000540    ETN66033.1    KK852427    KDR24107.1    KZ288187    PBC34719.1    GL447257    EFN86678.1    KQ434938    KZC12037.1    GBXI01013522    JAD00770.1    ATLV01022681    KE525335    KFB47945.1    GGFK01004863    MBW38184.1    JN003585    AEJ88361.1    GAKP01002543    GAKP01002542    JAC56410.1    GAKP01002541    JAC56411.1    GGFK01004599    MBW37920.1    ACPB03011632    KQ414666    KOC65001.1    UFQT01001180    SSX29359.1    AXCN02001762    KQ971317    EEZ99172.1    GL444420    EFN60907.1    GDIP01184281    JAJ39121.1    ABLF02037950    ABLF02037951    GDIP01193179    JAJ30223.1    GFXV01000266    MBW12071.1    CH479179    EDW25175.1    GGFL01015608    MBW79786.1    GDIP01194726    JAJ28676.1    JRES01000032    KNC34772.1    GDIQ01055810    JAN38927.1    GDIP01212074    JAJ11328.1    GDIQ01121173    JAL30553.1    GDIP01212073    GDIQ01187448    GDIQ01123724    JAJ11329.1    JAK64277.1    GDIP01184280    JAJ39122.1    GDIQ01266458    JAJ85266.1    OXU24804.1    GDIP01199234    JAJ24168.1    GDIQ01077337    JAN17400.1    GGFM01006040    MBW26791.1    GDIP01179325    JAJ44077.1   
Pfam
PF03098   An_peroxidase        + More
PF00083   Sugar_tr
PF00075   RNase_H
PF00651   BTB
Interpro
IPR010255   Haem_peroxidase_sf        + More
IPR037120   Haem_peroxidase_sf_animal       
IPR019791   Haem_peroxidase_animal       
IPR029585   Pxd-like       
IPR005828   MFS_sugar_transport-like       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
IPR016024   ARM-type_fold       
IPR000225   Armadillo       
IPR011333   SKP1/BTB/POZ_sf       
IPR011989   ARM-like       
IPR000210   BTB/POZ_dom       
SUPFAM
SSF48113   SSF48113        + More
SSF103473   SSF103473       
SSF53098   SSF53098       
SSF48371   SSF48371       
SSF54695   SSF54695       
Gene 3D
PDB
3R5Q     E-value=9.70533e-25,     Score=284

Ontologies

Topology

Length:
663
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03932
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00079
outside
1  -  663
 
 

Population Genetic Test Statistics

Pi
179.409607
Theta
176.080532
Tajima's D
0.025724
CLR
0.260009
CSRT
0.377481125943703
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27102218 SDPMCAPNFIPEFDPVHR 100.00 2e-10
27102218 DSGIIISSSWDSTAK 95.24 5e-09
24093152 EEFSDDEVDCFIPR 95.45 5e-09
24093152 SDMWMIFR 100.00 6e-07
27102218 ITSSGKEYPIAR 100.00 6e-07
24093152 WFHIVSEGDIK 100.00 0.019
27102218 PNRPHAFNHEQIQEIR 100.00 0.019
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号