SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12950
Annotation
PREDICTED:_uncharacterized_protein_LOC105842415_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.183
 

Sequence

CDS
ATGAGTGAGAAAGAAGAAAAGGAGTTAGTTAAAAAACGAGCTAGTCTAAAAGGCCGATTGACTACATTCAGAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTAAATGAATTGCAATTAAGAATCGGTAAGATCGAATTATTATTTGAACAATATGACGTAGTACAAACTAAAATAGAATGCCTCGCTGACGATTTCAGCTCGCAAAGCACAGAGAGAGAAGATTTTGAATCAATTTATTACAAATCCCTTTCACAGGCTCAGGAGATTCTTTCTCGTAATTCTAAATTGTTACAAACCCAAGTGCATAGTTTTGAGGGTTGCTCTCATGTGAGTAATCATAGCCTGGTTAAATTGCCTACCATTAGTCTACCCAAATTTAATGGTTCATATAGCAACTGGCTGGAATTCCATGACACCTTCAGTAGTCTTATACATTCGAACGAGGCGATAGGAGAAATTAATAAATTCCACTACCTCAGGGCCTCGCTAGAAGGCTCTGCTGCTGTACTGCTTCAGGAGATTCAGTTTTCTGCCAGCAACTATTCTGTGGCGTGGAAGCTGTTATGTGAGAGGTACGATAATAAGCGCCTATTAATTCAAACACACGTTAATAATTTATTTAATGTAGACGCAATAAAGAGTGAATCTTCATTTAATTTAAGACGTTTCATAGATCAGCTGAATAAAAGCCTCAGAGCTTTAGAGTCGCTGGGTGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGATGAGTCGTAAATTCGAACAGAAGACGCTGCGTGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATCTTTATCGATTTCATTCGTAACCGGGCCGATCTATTAGAAACGATGGAATTTACTCGCCCTAACCTTCCTCACACACAAGTTCAGCCACCACAGTCGCCTAAAGGTCAGAAAATTAAAACATTAGTTTCTGTGTCCGGAACGCAGCCGTCGTCGAGTGGCGGCGCTAGTATTATTTCTGGTTCCGGTACAACATCGTGCCCACACTGTAAGGTTCAAGGTGTGTTACAACTGCTTTCGTAG
Protein
MSEKEEKELVKKRASLKGRLTTFRKYIEELSGTLNQQQVNELQLRIGKIELLFEQYDVVQTKIECLADDFSSQSTEREDFESIYYKSLSQAQEILSRNSKLLQTQVHSFEGCSHVSNHSLVKLPTISLPKFNGSYSNWLEFHDTFSSLIHSNEAIGEINKFHYLRASLEGSAAVLLQEIQFSASNYSVAWKLLCERYDNKRLLIQTHVNNLFNVDAIKSESSFNLRRFIDQLNKSLRALESLGEPTDHWDTLLIHMMSRKFEQKTLREWEECKGRLDKEKPISLSIFIDFIRNRADLLETMEFTRPNLPHTQVQPPQSPKGQKIKTLVSVSGTQPSSSGGASIISGSGTTSCPHCKVQGVLQLLS

Summary

EMBL
NWSH01001945    PCG69607.1    BABH01022219    BABH01022220    BABH01004450    JTDY01001855    + More
KOB72712.1    JTDY01001654    KOB73239.1    JTDY01006305    JTDY01002831    KOB66118.1    KOB70633.1    KQ459312    KPJ01687.1    KQ460211    KPJ16510.1    KQ977505    KYN02283.1    JTDY01006550    JTDY01002030    JTDY01001260    KOB65898.1    KOB72276.1    KOB74365.1    KQ460205    KPJ16960.1    NWSH01001201    PCG72150.1    GALX01002843    JAB65623.1    GALX01002427    JAB66039.1    NWSH01001093    PCG72659.1    ODYU01011804    SOQ57759.1    GAIX01014054    JAA78506.1    LBMM01009058    KMQ88428.1    NWSH01000142    PCG79113.1    KQ460500    KPJ14270.1    GALX01005110    JAB63356.1    GALX01004000    JAB64466.1    GEZM01055231    JAV73081.1    KQ977342    KYN03430.1    KQ977963    KYM98425.1    GBHO01005506    GBHO01005503    JAG38098.1    JAG38101.1    GBGD01000063    JAC88826.1    RSAL01000402    RVE41913.1    KQ982464    KYQ56128.1    GDQN01003166    JAT87888.1    KQ978056    KYM97755.1    KQ981127    KYN09299.1    GGMR01004354    MBY16973.1    GGMR01014413    MBY27032.1    KQ977032    KYN06203.1    GGMR01011310    MBY23929.1    KQ978164    KYM96665.1    GEZM01018702    GEZM01018700    GEZM01018697    JAV90049.1    KQ981002    KYN10407.1    ABLF02021176    ABLF02066403    GBBI01004140    JAC14572.1    ABLF02006001    ABLF02006002    KQ979276    KYN22031.1    KQ977557    KYN02007.1    GEZM01086714    JAV59026.1    ABLF02041505    KQ982064    KYQ60564.1    JXUM01252006    KQ640254    KXJ62375.1    GGMR01020322    MBY32941.1    GEZM01012999    JAV92824.1    KQ977959    KYM98432.1    KQ982204    KYQ59009.1    KQ976954    KYN06860.1    KQ414692    KOC63604.1    KQ458793    KPJ04955.1    KQ973442    KXZ75531.1    LBMM01010061    KMQ87695.1    GBBI01004139    JAC14573.1    ABLF02023842    ABLF02028949    ABLF02058391    GEZM01086715    JAV59020.1    GGMR01007417    MBY20036.1    KQ460545    KPJ14069.1    GGMR01003885    MBY16504.1    GGMS01001896    MBY71099.1    ABLF02022040    ABLF02056888    ABLF02042264    GG695382    EFA13346.1    GGMR01009911    MBY22530.1    KQ978343    KYM95005.1    ABLF02004142    KQ978855    KYN27942.1    ABLF02006985    KQ978679    KYN29321.1    KQ979016    KYN24380.1    GGMR01018506    MBY31125.1    ABLF02013385    ABLF02029502    ABLF02029511    KQ434810    KZC06736.1    ABLF02016109    ABLF02016113    GBBI01004032    JAC14680.1    ABLF02026305    GGMR01017803    MBY30422.1    KQ980737    KYN13736.1    KQ978502    KYM93420.1    KQ981142    KYN09177.1    GGMR01020500    MBY33119.1   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF02201   SWIB
PF07679   I-set
PF02945   Endonuclease_7
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR003121   SWIB_MDM2_domain       
IPR036885   SWIB_MDM2_dom_sf       
IPR019835   SWIB_domain       
IPR001969   Aspartic_peptidase_AS       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
IPR038563   Endonuclease_7_sf       
IPR004211   Endonuclease_7       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF47592   SSF47592       
SSF48726   SSF48726       

Ontologies

Topology

Length:
365
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00107
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00993
outside
1  -  365
 
 

Population Genetic Test Statistics

Pi
245.840863
Theta
215.471336
Tajima's D
0.43656
CLR
0
CSRT
0.493125343732813
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号