SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12949  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000239
Annotation
PREDICTED:_peroxidase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 3.246
 

Sequence

CDS
ATGCAGCACGGTGCTCAAAAACTTCTTGATAAAAACTTTAATCTCATTAAAGAGGTACCGATGGTGAACTTCTCTCTGAGCGTCCAGTCTTTAGCTGTAGACGACATTATGTCGACCTTAACACGAGGATCGTATTATCAAGCTACTGGCAAAGCTGATTTCACCGTAGATCCTGATATATCAAATGTCGGCTTAGGACCCGTGCAAGAAGTTTTCGATATACCGACAGCAGATTTAGCTAAAGGCAGATATTTTGGACTACCTTCTTACACAAAATACAGAGACTTCTGCTCGGGCTATTCAAAAAAACATGTTGATTTCGACGATTTAACGGACCACATTAGTGATGAGAAAATACGACAGCTCAAACAAGTTTATGAGACGACCGAAGACATAGAACTTATGGCAGGTATTTGGGTGGAGAACTTAAAAGAAGGAGCTCACGTTCCACCAACTGTACACTGTTTGTTATCAAACCAGCTTAAAAGAAGTATTATCATTGACAGACATTGGTATGAAAGGCCTAATCGCCCACATGCCTTTAATTATGAACAACTTCAAGAAATTAGGAAAGCTTCTTTAGCGCTTCTGCTATGCTATGTGGGAGATGACGTTGAAAAAATCCAGCCCAAGGCTTTCGTTATCGTTGGAAAGGGAAACAATTTGGTCAGCTGTGATGAAATTCCGGCTATAGACTTTACACACTGGAAAGAAGAATCGTAA
Protein
MQHGAQKLLDKNFNLIKEVPMVNFSLSVQSLAVDDIMSTLTRGSYYQATGKADFTVDPDISNVGLGPVQEVFDIPTADLAKGRYFGLPSYTKYRDFCSGYSKKHVDFDDLTDHISDEKIRQLKQVYETTEDIELMAGIWVENLKEGAHVPPTVHCLLSNQLKRSIIIDRHWYERPNRPHAFNYEQLQEIRKASLALLLCYVGDDVEKIQPKAFVIVGKGNNLVSCDEIPAIDFTHWKEES

Summary

EMBL
BABH01013447    BABH01013448    BABH01013458    BABH01013459    BABH01013460    BABH01013455    + More
KQ459324    KPJ01645.1    KQ460416    KPJ14922.1    ODYU01008556    SOQ52260.1    AK405426    BAM20744.1    KPJ01647.1    AK402700    BAM19322.1    KJ995811    AIN39494.1    NWSH01006580    PCG63355.1    KZ149907    PZC78257.1    AGBW02012596    OWR44740.1    AK401278    BAM17900.1    NWSH01001320    PCG71707.1    BABH01034742    PZC78259.1    KPJ01646.1    KPJ14923.1    RSAL01000046    RVE50539.1    GDQN01000342    JAT90712.1    ODYU01007226    SOQ49823.1    ODYU01007063    SOQ49501.1    ODYU01007479    SOQ50286.1    NWSH01002854    PCG67434.1    PZC78258.1    BABH01034746    BABH01034747    BABH01028746    BABH01028747    BABH01028748    ODYU01006337    SOQ48101.1    ODYU01004596    SOQ44641.1    KZ149956    PZC76463.1    NWSH01001116    PCG72533.1    BABH01034743    BABH01034744    KQ459837    KPJ19761.1    NWSH01006200    PCG63597.1    PZC76461.1    RSAL01000083    RVE48485.1    PZC76464.1    NWSH01006414    PCG63451.1    KQ459564    KPI99614.1    RSAL01000844    RVE41111.1    KQ760645    OAD59676.1    JTDY01000732    KOB76072.1    KZ288187    PBC34719.1    PCG72532.1    ODYU01000046    SOQ34155.1    RSAL01001640    RVE40745.1    APGK01052663    APGK01052664    KB741213    ENN72650.1    KB631874    ERL86891.1    GBYB01000656    JAG70423.1    NNAY01001189    OXU24804.1    KQ414666    KOC65001.1    EF091968    ABN11960.1    JN003585    AEJ88361.1    GALX01004625    JAB63841.1    GGMR01015187    MBY27806.1    KQ971311    EEZ99334.2    GGMR01014369    MBY26988.1    OAD59675.1    GAKP01002543    GAKP01002542    JAC56410.1    GAKP01002541    JAC56411.1    GDHF01011408    GDHF01008719    JAI40906.1    JAI43595.1    KYB29427.1    GBXI01013522    JAD00770.1    GECU01021534    JAS86172.1    IAAA01005455    IAAA01005456    LAA02302.1    OXU24803.1    GDHC01005325    JAQ13304.1    AAAB01008848    EAA07042.4    APCN01003535    KQ460650    KPJ13122.1    NNAY01000120    OXU30782.1    GGMS01014387    MBY83590.1   
Pfam
PF03098   An_peroxidase        + More
PF00083   Sugar_tr
Interpro
IPR010255   Haem_peroxidase_sf        + More
IPR029585   Pxd-like       
IPR037120   Haem_peroxidase_sf_animal       
IPR019791   Haem_peroxidase_animal       
IPR005828   MFS_sugar_transport-like       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
SUPFAM
SSF48113   SSF48113        + More
SSF103473   SSF103473       
Gene 3D
PDB
3FAQ     E-value=4.07633e-12,     Score=170

Ontologies

Topology

Length:
240
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03599
Exp number, first 60 AAs:
0.03599
Total prob of N-in:
0.04522
outside
1  -  240
 
 

Population Genetic Test Statistics

Pi
156.906818
Theta
163.134673
Tajima's D
0.120704
CLR
0.457961
CSRT
0.398330083495825
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27102218 DSGIIISSSWDSTAK 95.24 1e-10
27102218 GNNIVSCDEIPAIDFTHWK 95.45 2e-10
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号