SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12943
Pre Gene Modal
BGIBMGA000632
Annotation
PREDICTED:_uncharacterized_protein_LOC105387844_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.459
 

Sequence

CDS
ATGAATTCATTTACAAAAACAGAAAATATAAACAGACTCAGAAGGAACCTGAAAGGAAGGGCAAAGGAAGCCGTTGACGGATTACTTATAACGAACGCTGATCCGTCCGACGTCATAAGAAGTCTAGAAGCGCGATTCGGAAGACCGGAAACAATAGCCATAACGGAGTTAGACACGCTACGAGCGCTGCCAAGACTAACAGAAACACCAAGAGACATTTGTATATTCTCCAGTAAGGTGACCAACGCCGTAGCTACGCTTCGTGCATTAAATTGCACACATTATTTATATAATCCGGAAACTACCAAAACAATGTTAGAAAAACTCACACCAACACTACGTTACCGATACTACGACTTCACCGCGGTACAACCGAAGGAGGATCCGGATCTGATTAAATTTGAAAAATTCATGAAAAGAGAAGCCGAACTGTGCAGCCCTTATGCACAGCCCGAACAGGCGGGGCACTACTCGCAGCCCGCACAACACAACAGACGCACACAGAACGTGCACATAGTCAGTGAGAAGCCATCACGAGCTAAATGTCCGGTATGTAGCAACACTGAACACACCACAACAGACTGCTACATATTCAAGAAGGCAGACTCAAACACAAGATGGGACATCGCTAAGAATAAACACCTGTGTTTCCGATGTCTACAGTATAAGAATAAAACCCACAACTGTAAACCGAGGACGTGTGGCATTAATGATTGCAAATATACTCACAACAAGATGCTACACTTCGACAGAAAAATTGAAAAAACAGACAACAGTGACAAGGAAACAACAGAGAACATTAATTCCGCTTGGACCGGAAAACAGAAACAGTCCTATTTGAAAATAATCCCAGTCCAAGTACAAGGACCGATAGGCACGGTTGATACATACGCGCTGCTCGACGATGGATCAACGGTAACACTGATAGACGAAATCATCTGCAAGAAGACTGGAATAACAGGACCAATCGATCCGTTACACATACAGGCGATTAACAACATAAAATCAACGGAAACAAGGTCAAGAAGAGTCAACCTCACGCTCAGAGGCCTCAACAGTCGAAAAGAAATAATACAAGCGAGAACAGTTAACGACCTACAAGTAACAGCACAAAAAATACCAAAGGAACAGATAGACGAGTATTCGCACCTACGAGACATCAGTGACATCATCACGTACGAGAACGCGAAACCTGGAATCCTGATTGGCCAAGACAACTGGCACATGCTACTAGCTTCGAAAGTTAGACGAGGCAACAGGAATCAGCCAATAGCGTCACTGACACCTCTAGGCTGGGTATTGCATGGAGGTCGCACTCGTACCCTAGGCCACCACATAAACTACATAAATCATGCTAGCGAAACCCAGGAAGATGATAAAATAGAAAATCTGGTAAAACAGTATTTCGCTATGGATGCGCTATGCATCACACCCAGAAGACCAAAAACAGACCCAGAGGAACAGGCGCTTCGCATCCTCAACAGCCATACAGTCCACACAACAGATGGAAGATACGAAACTGCTCTGCTCTGGAAAACAGGTAATGTCAGTCTACCAGACAACTACAATAACTCGTTAAAGCGACTGATAAATATAGAAAACAAACTCGATCGTAATCCGGAACTGAAACAGAAATACACAGAACAGATGGAAGCACTCGTCGCGAAAGGCTACGCCGAGCCCGCTCCAAAAACAAAAACAGAGAACAGAACGTGGTATCTACCTCACTTCGCCGTCGTGAACCCCCTGAAGCCGGAAAAACTCCGAGTCGTCCACGATGCCGCCGCCAGAACAAGAGGGGTAGCTTTAAATGATATGCTGCTTAAGGGACCGGACCTACTCCAATCACTACCAGGAGTGATAATGCGATTTAGACAGCATAATATAGCAATAACAGCAGACATCAAGGAGATGTTCATGCAAGTGAAATTGAGACATGAAGACAGAGACGCGCTCCGCTATCTCTGGCGCAAAGATCGCCGAGATGACAAGCCCCCAGAAGAATACAGAATGACCTCGTTGATCTTTGGTGCGTCAAGTTCTCCTTCCACAGCAATATATGTAAAGAACTTGAACGCCCAGAAACATGAAGCCACGCACCCGGAGGCGGCAGCCGCAATACAGAACAAACACTACGTAGACGACTACTTGGACAGCTTTAAAACTTTAAAAGATGCAGTACGCATAACAACAGACGTTCGTCGAATACACGAAAAAGCTCATTTTGAATTAAAACAGTGGAAGTCAAACTCGCCGAGCCTACTTGAAACCCTTGGTGAAAACGAAAATGGAAATCAAGTGGAACTGTACAAGCCTGAAGAAAAAACTGAACGAGTACTCGGGCTCATATGGAAAACAGAAAAGGACGTGCTTACCTTCGACCTCAATCTGACAAGAATACCTCCACCGCTCGTCGAAGGCAAGACGCCGACCAAGAGAGAAGCACTAAAAGTCGTAATGTCGTTATTCGATCCGCTAGGCTTCGTGTCCCCAGTCACAAATAGAGCAAAACAACTTCTGCAAGAAGTGTGGCGGCGAGGAACATCATGGGACGATGAAATAGATAACGACCTGTCGACACACTGGCAGGCCTGGGTGAAGCAGCTGAGAAACCTGCACAATATAGCCATCCCAAGATGTTACTTAAACTACAGCGACACGACCACATTACAGCTACACGTCTTCACCGACGCAAGTGAATCCGCCTACGCTGCAGCACTATACTGGCGAACGATAAGTCCGAATAATAGAATCGACGTGTCACTGATTATGAGCAAAGCAAAGGTAGCGCCCCTGAAACTCACTTCTATACCGAGACTGGAACTACAAGCCGCCGCTCTCGGAGCACGCCTCGCTGAAGCTGTAATAGCGGAACACGACAGAAAGCCGGATTCGAAGACCTTCTGGACCGACAGTAAGACAGTATTAACATGGATAAGAACGGGATCACGCTCGTACAAACCATACGTCGCCCACCGCCTGGCTGCTATAGAAGATAGTTCAACAGTAAACGAGTGGCGATGGGTACCCACGAAGCATAACGTGGCCGACGACGCAACTAGAGACGTGCCAATATCGTTCGACAACGAACACAGATGGTTCAGAGGACCGGAATTCCTACACCAGCAAGAAGAATCCTGGCCTACGGAATCAGCAACAGCAACAATAGAACCGACAGGTGAAGAAAAGATACATCACACGATCGCCGTCAACCTTAAAAACAGACTAACTGAAGGTTTACCAGACGTATCCCGGTTCTCGAATTGGGAAAGACTCCGATACACCACAGCCAGAGTCCTACAGTTTATACAACTTTGTAGGCGCAGAACAGAACAGGTACACCATAGAAAAAACAAAAGAAACAAAGAAGCAGACCCCGCGTGGGCCGAACGTAAACAACGAACAATGGTTTCGCCGAAATCCTTTAAAACCAAAACGGAAGATAGAAAATACCATCCGATCTCAGCTGAAACATTGAAAACGGCCGAGAAACTGCTTATGCGCGCGACACAAGAAGAAAGCTTCGCTCAAGAAATCAAGGACATCCAACAACGAGGAGGCGTGAACCAGAATAGCCGCCTCCACAAACTCAGTATTGTATATGAGAACGGATACCTACGAATACGAAGCCGTATCGAAGCAGCAGAACGAATACCAACAGAAATAAAGAGCCCGGTGATCCTGGACGGAAACCACCTCACAACTAAGTTGTGGATAAAATATATTCATCACAGATTACATCATGCTGGAGTCGAAGCTACAATTAACGAGTGTCGTCAGCAATACTGGATAGTGCGTATACGCCCAGTGACTCGCACCATAGTAAACAAATGCCTACAATGCAGAATGAAGACACAGATACCGTCGTATCCGAGGACCGGAGATCTACCACCGTGCCGTCTAGCCCATCACAAAAGACCATTCACTTTCACGGGAGTTGATTACTTCGGTCCGCTAACAGTCACAGTCGGACGAACCAACCAAAAGCGATACGTAGCAATATTCACTTGTCTAACAATACGAGCCATACATCTTGAAATAGCCGCATCACTAAACACCCACTCTGCGGTAATGGCGCTCCGAAGAATGATAGCACGACGAGGTTGTCCGACGCAGATATGGTCGGACAACGGCACCAACTTAAAAGGAGCAGACAGAGAACTACGCCGAGCCATCGACGGTGCAACCGCAAAGGAAGCAGCGAACAGAACGATCTCCTGGAGATTCATCCCACCCGGAGCACCGTTCATGGGAGGTGCCTGGGAAAGGATGGTGCGCTCGGTAAAGGTCGCGTTAACGGCAACACTCCATGAGCGAAGTCCGACGGAGGAAGTGCTCTCGACGTTATTAGCTGAAATAGAATATACGGTAAACAGTCGGCCTTTGACTCACGTTTCGGTCAGCGTGGACGACCCCGAAGCCCTAACCCCGAACCACTTACTACTAGGCGGGCCGGGGCGAGTACCAACACCAGGGACATTTGATGAAAGAGACACATTGACGCGAAACAGTTGGAGAGCGGCACAACGACTCGCTGACCTGTTCTGGACGAGGTGGGTTAGAGAGTATCTCCCCGAGCTGCAGCACCGGCGGGAGCCTCATGGCCGAGGCATCCCCGTGAAAAACGGAGATTTAGTCCAGCTTGTGGACAACAACTTGCCACGAAACACATGGGTGCGAGGAAAAGTGATCGCGACGTATCCAGGACCCGACAACGTGGTGCGCACCGTAGATATCAGAACCAAAGGGGGAGTTCTACGGAGACCAGTACGAAAACTAGTGATCCTGCCCATAGAAGACGACCATCCTGCACCGAGAAGAAATGCGACGGACTCGCACGGCGGGAGTAATGTGCAGGACGAAATCGATTTTAAATAG
Protein
MNSFTKTENINRLRRNLKGRAKEAVDGLLITNADPSDVIRSLEARFGRPETIAITELDTLRALPRLTETPRDICIFSSKVTNAVATLRALNCTHYLYNPETTKTMLEKLTPTLRYRYYDFTAVQPKEDPDLIKFEKFMKREAELCSPYAQPEQAGHYSQPAQHNRRTQNVHIVSEKPSRAKCPVCSNTEHTTTDCYIFKKADSNTRWDIAKNKHLCFRCLQYKNKTHNCKPRTCGINDCKYTHNKMLHFDRKIEKTDNSDKETTENINSAWTGKQKQSYLKIIPVQVQGPIGTVDTYALLDDGSTVTLIDEIICKKTGITGPIDPLHIQAINNIKSTETRSRRVNLTLRGLNSRKEIIQARTVNDLQVTAQKIPKEQIDEYSHLRDISDIITYENAKPGILIGQDNWHMLLASKVRRGNRNQPIASLTPLGWVLHGGRTRTLGHHINYINHASETQEDDKIENLVKQYFAMDALCITPRRPKTDPEEQALRILNSHTVHTTDGRYETALLWKTGNVSLPDNYNNSLKRLINIENKLDRNPELKQKYTEQMEALVAKGYAEPAPKTKTENRTWYLPHFAVVNPLKPEKLRVVHDAAARTRGVALNDMLLKGPDLLQSLPGVIMRFRQHNIAITADIKEMFMQVKLRHEDRDALRYLWRKDRRDDKPPEEYRMTSLIFGASSSPSTAIYVKNLNAQKHEATHPEAAAAIQNKHYVDDYLDSFKTLKDAVRITTDVRRIHEKAHFELKQWKSNSPSLLETLGENENGNQVELYKPEEKTERVLGLIWKTEKDVLTFDLNLTRIPPPLVEGKTPTKREALKVVMSLFDPLGFVSPVTNRAKQLLQEVWRRGTSWDDEIDNDLSTHWQAWVKQLRNLHNIAIPRCYLNYSDTTTLQLHVFTDASESAYAAALYWRTISPNNRIDVSLIMSKAKVAPLKLTSIPRLELQAAALGARLAEAVIAEHDRKPDSKTFWTDSKTVLTWIRTGSRSYKPYVAHRLAAIEDSSTVNEWRWVPTKHNVADDATRDVPISFDNEHRWFRGPEFLHQQEESWPTESATATIEPTGEEKIHHTIAVNLKNRLTEGLPDVSRFSNWERLRYTTARVLQFIQLCRRRTEQVHHRKNKRNKEADPAWAERKQRTMVSPKSFKTKTEDRKYHPISAETLKTAEKLLMRATQEESFAQEIKDIQQRGGVNQNSRLHKLSIVYENGYLRIRSRIEAAERIPTEIKSPVILDGNHLTTKLWIKYIHHRLHHAGVEATINECRQQYWIVRIRPVTRTIVNKCLQCRMKTQIPSYPRTGDLPPCRLAHHKRPFTFTGVDYFGPLTVTVGRTNQKRYVAIFTCLTIRAIHLEIAASLNTHSAVMALRRMIARRGCPTQIWSDNGTNLKGADRELRRAIDGATAKEAANRTISWRFIPPGAPFMGGAWERMVRSVKVALTATLHERSPTEEVLSTLLAEIEYTVNSRPLTHVSVSVDDPEALTPNHLLLGGPGRVPTPGTFDERDTLTRNSWRAAQRLADLFWTRWVREYLPELQHRREPHGRGIPVKNGDLVQLVDNNLPRNTWVRGKVIATYPGPDNVVRTVDIRTKGGVLRRPVRKLVILPIEDDHPAPRRNATDSHGGSNVQDEIDFK

Summary

EMBL
AF530470    AAQ09229.1    RSAL01000375    RVE42106.1    KQ459986    KPJ18861.1    + More
LNIX01000007    OXA52015.1    LNIX01000019    OXA44855.1    LNIX01000004    OXA55241.1    LNIX01000015    OXA46575.1    LNIX01000039    OXA39294.1    LNIX01000003    OXA57597.1    GAMC01017930    JAB88625.1    JXUM01136032    KQ568367    KXJ69026.1    GDHC01018323    JAQ00306.1    JXUM01127084    KQ567147    KXJ69602.1    GEZM01052586    JAV74401.1    LN877231    CTR11689.1    JXUM01111221    KQ565482    KXJ70922.1    GGFL01001682    MBW65860.1    GGFL01001842    MBW66020.1    JXUM01130316    KQ567562    KXJ69370.1    OXA56382.1    OXA55408.1    GGFJ01000333    MBW49474.1    GGFJ01000306    MBW49447.1    GEHC01000947    JAV46698.1    GEHC01000967    JAV46678.1    JXUM01038372    KQ561162    KXJ79503.1    GEHC01000945    JAV46700.1    OXA56250.1    GGFJ01000218    MBW49359.1    GGFL01005193    MBW69371.1    GEHC01000913    JAV46732.1    GEHC01000921    JAV46724.1    GGFJ01000302    MBW49443.1    KL367480    KFD71819.1    AAGJ04043389    AAGJ04115911    GEHC01000914    JAV46731.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    AB110069    BAD01590.1    BAD01589.1    AAGJ04040339    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    AAGJ04058558    AAGJ04095911    AAGJ04001285    GDIQ01002920    JAN91817.1    NSIT01000285    PJE78034.1    GAMC01020594    JAB85961.1    NWSH01005440    PCG64209.1    KL367737    KFD59786.1    JXUM01031097    KQ560909    KXJ80382.1    GDIQ01002921    JAN91816.1    AAGJ04091218    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GGFJ01000487    MBW49628.1    GGFJ01000432    MBW49573.1    AAGJ04132022    LSMT01001301    PFX12555.1    JYDI01000333    KRY45736.1    GEZM01052587    JAV74399.1    JYDL01000102    KRX16693.1    KL367570    KFD63600.1    GEHC01000872    JAV46773.1    KL367527    KFD66131.1    GCES01095441    JAQ90881.1    HAEJ01014775    SBS55232.1    JYDM01000385    KRZ82062.1    JYDM01000241    KRZ82930.1    JYDT01000339    KRY80750.1    GEHC01000955    JAV46690.1    JYDT01000018    KRY90876.1    JYDI01000018    KRY58771.1    HAEJ01004262    SBS44719.1    JYDK01000490    KRX63735.1    JYDH01000025    KRY38464.1    JXUM01005879    KQ560203    KXJ83865.1    AAGJ04094839    JYDV01000070    KRZ36622.1    AAGJ04005692    JYDM01000403    KRZ82016.1    HADW01020537    HADX01002217    SBP21937.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF05585   DUF1758
PF17921   Integrase_H2C2
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
PF01048   PNP_UDP_1
PF13855   LRR_8
PF18738   HEPN_DZIP3
PF17919   RT_RNaseH_2
PF14943   MRP-S26
PF00271   Helicase_C
PF00270   DEAD
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR002999   Tudor       
IPR001841   Znf_RING       
IPR000477   RT_dom       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR003961   FN3_dom       
IPR035994   Nucleoside_phosphorylase_sf       
IPR000845   Nucleoside_phosphorylase_d       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR041577   RT_RNaseH_2       
IPR027417   P-loop_NTPase       
IPR026140   MRPS26       
IPR013026   TPR-contain_dom       
IPR011545   DEAD/DEAH_box_helicase_dom       
IPR019734   TPR_repeat       
IPR001650   Helicase_C       
IPR011990   TPR-like_helical_dom_sf       
IPR014001   Helicase_ATP-bd       
IPR036875   Znf_CCHC_sf       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF53167   SSF53167       
SSF52540   SSF52540       
SSF48452   SSF48452       
SSF57756   SSF57756       
PDB
4BAC     E-value=0.0273942,     Score=94

Ontologies

Topology

Length:
1625
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03195
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00020
outside
1  -  1625
 
 

Population Genetic Test Statistics

Pi
22.812635
Theta
21.089706
Tajima's D
0.248969
CLR
6.439086
CSRT
0.447477626118694
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号