SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12910
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.001
 

Sequence

CDS
ATGGTCTGGCATAGGGCACTTCTATCGAAGCTTCCAGCATACGGGATCCCTGAGGGACTCTGCAAGTGGATCGCTAGCTTTTTGGATGGACGGAGCATTGCAGTTGTCGTCGACGGCTGCTGCTCCGATACCATGACCATCAACGCTGGTGTTCCACAAGGTGCGGTGCTCTCCCCCACGCTTTTCATACTGCATATCAATGACATGCTATCTATTGATGGCATGCATGGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGAAGCGTTGTACACGAGAGGCGATTAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGGGTCTCCAAGTGGGGTGAACTGAATTCAGTTCAGTTCAACCCATTGAAGACACAGGTTTGCGCGTTCACTGCGAAGAAGGACCCTTTTGCCATGGCGCCGGAATTTCAAGGAGTATCCCTGCAGCTTTCCGCGAGTATCGGGATTCTGGGGGTCGATATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGTAAAGCCAAATTGGCCTCTAAAATGTTGGGAGTTCTCAACAGAGCGAAGCGGTATTTCACGCCTAGACAGAGACTTGCGCTTTATAAAGCGCAGGTCCGACCTCGCGTGGAGTACTGCTCTCACCTCTGGGCCGGGGCTCCCAAATACCAGCTACTTCCATTTGACTCCATACAGAAACGGGCTGTTCGGATGGTCGATAGTCCTGCTCTCGCGGATCGCTTGGAACCTCTGGGTCTACGGAGGGACTTCGGTTCTCTCTGTGTTTTATACCGCATGGTCCATGGGGAATGCTCTGAGGAATTATTCGAGATGATTCCCTCATCTCCTTTTTATCATCGCACCTCCCGCCATCGGAGCAGAGTTCATCCATATTATCTGAAACCGCTGCGTTTATCGACAGTGCGTTTCCAAAGATCTTTTTTGCCACGTACCATCCGGCTTTGGAATGAGCTCCCCTCCACGGTGTTTTCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGCGGAGAGTTCTTTATGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGACGTCCATGAGCGACGGTGA
Protein
MVWHRALLSKLPAYGIPEGLCKWIASFLDGRSIAVVVDGCCSDTMTINAGVPQGAVLSPTLFILHINDMLSIDGMHGYADDSTGDARYIGHQSLSRSVVHERRLKLVSEVENSLGRVSKWGELNSVQFNPLKTQVCAFTAKKDPFAMAPEFQGVSLQLSASIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPRQRLALYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQKRAVRMVDSPALADRLEPLGLRRDFGSLCVLYRMVHGECSEELFEMIPSSPFYHRTSRHRSRVHPYYLKPLRLSTVRFQRSFLPRTIRLWNELPSTVFSERYDMSFFKRGLRRVLYGRQRLGSAPGIADVHERR

Summary

EMBL
AY359886    AAQ57129.1    RSAL01002067    RVE40593.1    RSAL01000422    RVE41792.1    + More
RSAL01000002    RVE54942.1    RSAL01000090    RVE48098.1    RSAL01003136    RVE40332.1    RVE55041.1    RVE55094.1    ODYU01002162    SOQ39302.1    GDRN01105059    JAI57791.1    DPOC01000269    HCX22453.1    GEFM01006421    JAP69375.1    NSIT01000412    PJE77717.1    GEFM01006417    JAP69379.1    FLMD02000154    SCV66010.1    GEGO01004295    JAR91109.1    GDRN01111334    JAI56796.1    HAAD01000593    CDG66825.1    AAGJ04095885    FLMD02000280    SCV66640.1    NSIT01000218    PJE78268.1    NSIT01000271    PJE78081.1    AAGJ04103823    NSIT01000538    PJE77518.1    GADI01001229    JAA72579.1    DS269285    EFP11931.1    NSIT01000164    PJE78524.1    AAGJ04090645    GFAC01000919    JAT98269.1    GEGO01003312    JAR92092.1    GFAC01005653    JAT93535.1    AAGJ04096877    GEGO01003518    JAR91886.1    AGCU01081420    NSIT01000477    PJE77602.1    NSIT01000239    PJE78188.1    AGCU01135984    NSIT01000462    PJE77627.1    QRBI01000116    RMC08860.1    GEFM01002394    JAP73402.1    GFAA01002514    JAU00921.1    AGCU01046616    AGCU01003726    AGCU01168427    GEGO01004422    JAR90982.1    NSIT01000532    PJE77527.1    GDRN01111277    JAI56804.1    GEGO01004061    JAR91343.1    NEDP02004020    OWF47171.1    QRBI01000171    RMB96954.1    AGCU01156312    AGCU01064953    AGCU01096477    NEDP02002425    OWF50811.1    NSIT01000637    PJE77413.1    GFAA01002479    JAU00956.1    AGCU01190758    AGCU01115937    AAGJ04014892    QRBI01000146    RMB99817.1    NSIT01000300    PJE77993.1    AGCU01156992    AGCU01018596    AGCU01164164    GFAA01002385    JAU01050.1    MRZV01000639    PIK46517.1    AGCU01055496    AGCU01076500    AGCU01061849    GEFM01006250    JAP69546.1    AGCU01001404    KZ505886    PKU43598.1    AGCU01130115    AGCU01106812    AGCU01002265    AGCU01155839    LSMT01000248    PFX22193.1    AGCU01038874    AGCU01124718    AGCU01148950    GFAC01007905    JAT91283.1    AGCU01124120   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01585   G-patch
PF04939   RRS1
PF02460   Patched
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR034653   SPF45_RRM       
IPR003954   RRM_dom_euk       
IPR000467   G_patch_dom       
IPR040052   RBM17       
IPR035979   RBD_domain_sf       
IPR007023   Ribosom_reg       
IPR030223   Dispatched       
IPR003392   Ptc/Disp       
IPR000731   SSD       
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF56219   SSF56219        + More
SSF54928   SSF54928       
SSF57903   SSF57903       
Gene 3D

Ontologies

Topology

Length:
373
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.117
Exp number, first 60 AAs:
0.07847
Total prob of N-in:
0.01779
outside
1  -  373
 
 

Population Genetic Test Statistics

Pi
43.630398
Theta
43.637629
Tajima's D
-1.032316
CLR
0.054193
CSRT
0.133943302834858
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号