SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12899  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014536
Annotation
heat_shock_protein_68_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.541
 

Sequence

CDS
ATGCCTGCTATAGGGATAGATCTTGGAACTACATATTCATGTGTTGGAGTTTGGCAACATGGAAACGTGGAGATCATCGCTAACGACCAAGGAAACCGGACTACACCCTCATATGTTGCATTCACGGACACAGAGAGACTCATTGGTGATGCTGCTAAAAATCAAGTAGCACTCAACCCTAGTAATACGGTGTTCGATGCGAAAAGACTAATCGGTCGCAAGTTTGATGATGCCAAGATACAACAAGACCTGAAACATTGGCCATTCAAAGTGATAAGTGATTGTGGAAAGCCCAAAATCCAGATAGAATTCAAAGGCGAAACAAAACGTTTTGCACCTGAGGAAATCAGCAGTATGGTGTTAATAAAAATGAGAGAGACCGCTGAAGCATATCTTGGAACAGCAATACGAGATGCAGTCATCACCGTTCCTGCTTATTTTAACGATTCACAGCGTCAGGCCACAAAAGACGCTGGAGCTATCGCTGGTCTGAATGTGCTTCGTATTATAAATGAACCGACAGCAGCAGCACTCGCTTATGGATTGGATAAAAATTTAAAAGGCGAACGAAACGTTCTTATTTTCGACCTCGGTGGTGGAACATTCGATGTTTCCATACTGACCATTGATGAAGGTTCATTATTTGAGGTAAAAGCCACTGCAGGCGATACTCATCTAGGCGGTGAAGATTTTGATAATAGATTGGTGAACCACCTAGCTGAAGAGTTTAAACGGAAATACAAGAGAGATATAACCAGCAATCCTCGCGCTCTTCGCCGGCTTCGGACTGCAGCTGAACGGGCGAAACGAACATTATCATCGAGCACGGAAGCTACCATTGAAATAGATGCTTTGTACGAAGGCATTGATTTCTACACTAGAGTATCTCGTGCACGTTTTGAAGAATTAAATGCTGATCTGTTCCGAGGAACACTGGAACCTGTCGAGAAAGCTCTGAAAGATGCGAAACTAGATAAAAGCTCTATTCACGACGTAGTTCTCGTTGGAGGATCGACACGCATTCCAAAAATACAGAGCATGTTACAAAACTTCTTCTGTGGAAAGAAACTAAATCTTTCAATCAATCCGGATGAAGCGGTAGCATACGGAGCTGCTGTACAAGCAGCAATTTTGAGTGGAGAGCAACACAGTAAAATTCAAGATGTTCTTTTGGTTGACGTCGCTCCCTTATCTTTGGGCATTGAAACTGCCGGTGGTGTAATGACAAAGATCATTGAACGCAACGCTAAAATTCCATGCAAGCAATCACAGACATTCACGACATATTCTGACAGCCAACCAGCAGTCACAATACAAGTGTACGAGGGCGAACGGGCCATGACCAAGGACAACAATATGTTGGGTCGCTTCGATCTAACTGGAATTCCACCTGCACCACGGGGGGTCCCAAAGATCGACGTGACATTCGATATCGACGCCAACGGGATCTTAAATGTCTCCGCTAAAGAAAACGGCACTGGCCGCAGTAAAAACATCGTTATTAAAAATGATAAGGGACGATTATCTCAAGCTGAAATCGACCGTATGGTAGCAGAAGCCGAACGCTATAAGGAAGAAGATGATCGACAAAGAGAAAGGGTAGCAGCACGCAATCAATTGGAAACTTACATTTTCAACGTTAAACAAGCCGTTGATGATGCCGGTGACAAACTGAGCGCACAAGACAAAGAGAGCGTAAGAAACGATTGCGAGGCCGCCCTGCGATGGTTGGACAATAACACGCTAGCTGAAAAAGATGAATTTCAGCAGAAACTAAAGGATCTTCAGCAAGTTTGTTCACCAGTCATGAGCAAGATCCACGCTACGGGTAGTCAACAGTATTCACAGCCCAATCGTTCAGGGCCAACGGTTGAAGAAGTTGATTAA
Protein
MPAIGIDLGTTYSCVGVWQHGNVEIIANDQGNRTTPSYVAFTDTERLIGDAAKNQVALNPSNTVFDAKRLIGRKFDDAKIQQDLKHWPFKVISDCGKPKIQIEFKGETKRFAPEEISSMVLIKMRETAEAYLGTAIRDAVITVPAYFNDSQRQATKDAGAIAGLNVLRIINEPTAAALAYGLDKNLKGERNVLIFDLGGGTFDVSILTIDEGSLFEVKATAGDTHLGGEDFDNRLVNHLAEEFKRKYKRDITSNPRALRRLRTAAERAKRTLSSSTEATIEIDALYEGIDFYTRVSRARFEELNADLFRGTLEPVEKALKDAKLDKSSIHDVVLVGGSTRIPKIQSMLQNFFCGKKLNLSINPDEAVAYGAAVQAAILSGEQHSKIQDVLLVDVAPLSLGIETAGGVMTKIIERNAKIPCKQSQTFTTYSDSQPAVTIQVYEGERAMTKDNNMLGRFDLTGIPPAPRGVPKIDVTFDIDANGILNVSAKENGTGRSKNIVIKNDKGRLSQAEIDRMVAEAERYKEEDDRQRERVAARNQLETYIFNVKQAVDDAGDKLSAQDKESVRNDCEAALRWLDNNTLAEKDEFQQKLKDLQQVCSPVMSKIHATGSQQYSQPNRSGPTVEEVD

Summary

Similarity
Belongs to the heat shock protein 70 family.
EMBL
BABH01042878    JF836795    AEI58997.1    JX680677    AGR84224.1    ODYU01007205    + More
SOQ49779.1    KT225460    ALL42052.1    AGBW02009136    OWR51575.1    GQ389711    ACV32640.1    HM593518    ADP37711.1    JX680676    AGR84223.1    JX680669    AGR84216.1    JF836794    AEI58996.1    KY930331    ATL76715.1    JX680670    AGR84217.1    AB035326    BAF69068.1    HQ012004    ADV03160.1    AGBW02009614    OWR50325.1    DQ311189    ABD36134.1    FJ862049    ACQ78180.1    FJ754276    ACN78407.1    KZ150133    PZC73022.1    EU430480    ABZ10939.1    JTDY01004123    KOB68565.1    HM370510    ADK94698.1    JQ693014    AFQ37587.1    GQ199477    ACS72236.1    AB179657    BAD18974.1    KQ458671    KPJ05577.1    GU945198    KR821069    ADI50267.1    ALL42057.1    HM370511    ADK94699.1    AB251895    BAF03555.1    HM370509    ADK94697.1    EF523381    ABP93405.1    JQ316541    AFO70209.1    JX678981    AFU06382.1    AY220911    AAO65964.1    JN863694    AFK93489.2    JN863695    AFK93490.1    AB325801    BAF95560.1    JQ693015    AFQ37588.1    JQ711194    AFQ33498.1    HQ107971    ADV58254.1    HQ107972    ADV58255.1    KJ701421    AID61521.1    MG265913    AXU24969.1    HM212645    ADK39311.1    GBBI01002050    JAC16662.1    GBBI01002049    JAC16663.1    GEBQ01026193    JAT13784.1    ACPB03005879    KY705383    ARW29609.1    KQ971357    KYB26038.1    JX112893    AFP54305.1    KY705385    ARW29611.1    HM367079    ADO14473.1    APGK01039299    KB740969    KB632230    ENN76738.1    ERL90377.1    KT003964    ANJ86404.1    HM013709    ADG03465.1    EF569673    ABQ39970.1    KX695168    AQP31338.1    DQ093385    ACZ52196.1    EU934244    ACH85201.1    KQ971352    EFA07459.1    EFA07510.1    MG265899    AXU24955.1    KX976473    AQP31363.1    AGBW02010783    OWR47855.1    GU074513    ACY71070.1    EU861391    ACF74975.2    NWSH01002246    PCG68835.1    EU934240    ACH85197.1    APGK01039300    BT127689    AEE62651.1    ENN76739.1    ERL90378.1    JX627810    AFX84560.1    GBBI01002093    JAC16619.1    MH042023    AXJ21598.1    KC620440    AHE77387.1    KY705384    ARW29610.1    JF421286    AEB52075.1    GFTR01007568    JAW08858.1    GAKP01020060    JAC38892.1    KF018929    AGT99186.1    CH933806    EDW14253.1    AJWK01021311    KJ867518    AIK01869.1    HQ184405    ADX42270.1    NEVH01025635    PNF15343.1    KY661325    AVA17412.1    GEDC01012328    JAS24970.1    HM141537    ADJ96610.1    GDHF01004711    JAI47603.1    GDHC01018490    GDHC01014986    JAQ00139.1    JAQ03643.1    KQ971354    EFA07173.1    PNF15290.1    HQ184404    ADX42267.1    KU311038    AMQ77288.1    AY842476    AAW32098.2    HM141536    ADJ96609.1    KU159184    AMX23517.1    ADX42268.1   
Pfam
PF00012   HSP70
Interpro
IPR013126   Hsp_70_fam        + More
IPR029047   HSP70_peptide-bd_sf       
IPR029048   HSP70_C_sf       
IPR018181   Heat_shock_70_CS       
SUPFAM
SSF100920   SSF100920        + More
SSF100934   SSF100934       
Gene 3D
PDB
5FPN     E-value=0,     Score=2200

Ontologies

Topology

Length:
628
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00585
Exp number, first 60 AAs:
0.00043
Total prob of N-in:
0.00028
outside
1  -  628
 
 

Population Genetic Test Statistics

Pi
227.731607
Theta
217.094278
Tajima's D
0.154279
CLR
0.630055
CSRT
0.419479026048698
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
20518026 MEELTRHCSPIMTK 95.24 4e-09
20518026 WLDSNTTAEK 95.24 4e-09
25044914 TISSAIIYMQR 95.45 1e-07
20518026 TTPSYVAFTDTER 100.00 5e-07
20518026 GANKCFSPEEISSMVLTK 100.00 6e-06
20518026 FAPEEISSMVLTK 100.00 6e-06
20518026 DAGAIAGLNVLR 100.00 5e-04
20518026 DAGAIAGINVLR 100.00 5e-04
26280517 DATTIGYIDADTAIIKDNIK 100.00 6e-04
28556443 ASNGDAWVQGTDGK 100.00 0.004
28556443 IINEPTAAAIAY 100.00 0.004
20518026 IEDVGEDEDADK 100.00 0.032
31223520 ARFEELNADLFR 100.00 0.032
26822097 FEEINADIFR 100.00 0.032
26280517 MNFSHGSHEYHAETIR 100.00 0.032
25044914 TTPQIVIR 100.00 0.032
24093152 TTPAAADVEK 100.00 0.032
24402669 TTPQIVIR 100.00 0.032
27102218 VEIIANDQGNR 100.00 0.032
28467696 TTPSSQIEQIIPSYTEIK 100.00 0.032
29197581 YPGPIQDVGNR 100.00 0.032
28556443 TTPSYVAFTDTER 100.00 0.032
28556443 TTPSYVAFTDTER 100.00 0.032
28556443 TTPSYVAFTDTER 100.00 0.032
28556443 TIEDGIFEVK 100.00 0.032
28556443 TFFPEEVSSMVLTK 100.00 0.032
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号