SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12882
Pre Gene Modal
BGIBMGA013961
Annotation
PREDICTED:_Down_syndrome_cell_adhesion_molecule-like_protein_Dscam2_[Plutella_xylostella]
Full name
Ribosomal protein L19      
Location in the cell
Nuclear   Reliability : 2.338
 

Sequence

CDS
ATGAAATTCGCAAAATTATTGGGGAATTACTGGTGGATCATACAGGATAAAGGGGACAAGGATAATCCTGTCAAATCTGCCATTGTGATATTCGACAGAAGTCTGGTAGTAATTGAAAATAATTTACTCATAGATCGTAACATAGTAGCTGTTACGATAGATACACAGGGACATAGAATCGGGTGCATCTCAGTTTACTGGGAGGATTACGTGAACGTGGACACATATCTAAACAAACTACAATACGTAATCAACAATCTAAAAACGGACACTTATATAGTTGGTGGTGATGTAAATGCTCGTAGCCAGTGGTGGGGATGCCCCAAAGACGATATAAGAGGAGCGGCTATCGCCGTTTTCTTAGCCCAGAATGATCTCCAAATACTAAACAAAGGAAACACCCCTACATTTTGGACTGTCAGACAAAACAGGCTGTACACAAGTATAATAGATATAACGGCATGCAGTGACGGACTTCTCAACTCAATATCAGATTGGAAAGTAGATGAGAATCTAATCACCACCTCCGATCATCGCTCAATCACGTTCAGCGTCGACCTTACCGGGAACAGAGGTTCTCAGAAAGGAAATCTTACCACTACAAAGAAATACAATACTAATAAAGCAAACTGGCCTAAATTCAAAAATAAACTACTAGAGCAATTCTCTGAACGAAATATCACAGTTGAAACCATCGCCTCAAAAACTGACAACGAAGAGTTCAACAAAATGGTAGAGGACTACGCGGGATGCATTGCGGTAGCTTGTGATTCCGCGATTCCTCTGATTGACCATAGTAAAAATCAATGTAGGCTATCCTGGTGGACCAAAGAACTAACCGAACTTAAAAATGAGGTTAAAAGAATCAGAAGCAAGATTAGGAAGGCAAACCCTAGAAGAAGGCCGCTTCTGATAAAAGATTATCAAGAAAGGTTAAAAGAATATAAACACACAATAATCACAACGAGGACCACCAGTTGGAAAGATTATACATCACGACAGAAGAGAGAATCGATGTGGGATAAATTCTACCGCATTATACGTACTAATAATAGAAGCAGAGATGAGGTGATGCTCAAGAAAGGGAATGACGTCCTCGATCCCCTCAAATCCGCAGAACTACTAGCTGATACATTCTATCCTAAGGACAATAAAGATATCGAAAACGAAGAACATCACCAATGTCCTAGATTCGGATTTAGACGCATAGAAACAGAACAGATCTTGGACTTTGCCATGGTCGCTCAAAACTTCCCCAGTATTATCGAGGACGACAGTGCTAGAGAAGCGTTCCTGAAATTCGCTATAAACAGTATAAAAATTGCCAACAACAGAAATAATAGTATAATGAAATACGCTATAGATTAA
Protein
MKFAKLLGNYWWIIQDKGDKDNPVKSAIVIFDRSLVVIENNLLIDRNIVAVTIDTQGHRIGCISVYWEDYVNVDTYLNKLQYVINNLKTDTYIVGGDVNARSQWWGCPKDDIRGAAIAVFLAQNDLQILNKGNTPTFWTVRQNRLYTSIIDITACSDGLLNSISDWKVDENLITTSDHRSITFSVDLTGNRGSQKGNLTTTKKYNTNKANWPKFKNKLLEQFSERNITVETIASKTDNEEFNKMVEDYAGCIAVACDSAIPLIDHSKNQCRLSWWTKELTELKNEVKRIRSKIRKANPRRRPLLIKDYQERLKEYKHTIITTRTTSWKDYTSRQKRESMWDKFYRIIRTNNRSRDEVMLKKGNDVLDPLKSAELLADTFYPKDNKDIENEEHHQCPRFGFRRIETEQILDFAMVAQNFPSIIEDDSAREAFLKFAINSIKIANNRNNSIMKYAID

Summary

Similarity
Belongs to the eukaryotic ribosomal protein eL19 family.
EMBL
AB046673    BAB21516.1    AB046675    BAB21518.1    AB046669    BAB21512.1    + More
AB046674    BAB21517.1    AB046672    BAB21515.1    AB046670    BAB21513.1    AB046671    BAB21514.1    KQ461108    KPJ08991.1    AB046668    BAB21511.1    D38414    BAA07467.1    AGBW02009775    OWR49941.1    AAZX01008070    KK854804    PTY18889.1    GECZ01021958    JAS47811.1    MUJZ01008278    OTF82483.1    LBMM01006940    KMQ90177.1    KK855758    PTY23794.1    GBBI01004920    JAC13792.1    KK115320    KFM64783.1    AAZX01018244    GEGO01007232    JAR88172.1    LBMM01006945    KMQ90173.1    LBMM01015285    KMQ84870.1    LBMM01015025    KMQ84953.1    KK856129    PTY24964.1    ABLF02021798    ABLF02021805    ABLF02021806    ABLF02023973    ABLF02031332    ABLF02031333    ABLF02031339    ABLF02046725    ABLF02054971    ABLF02056555    GEDC01016405    JAS20893.1    GFTR01008469    JAW07957.1    AGBW02008417    OWR53447.1    GEDC01005462    JAS31836.1    GEDC01008950    JAS28348.1    GDAI01002592    JAI15011.1    GDAI01002584    JAI15019.1    ABLF02008889    ABLF02041820    ABLF02007471    ABLF02007472    GFTR01008639    JAW07787.1    ABLF02014650    ABLF02019936    ABLF02057951    LBMM01009610    KMQ87992.1    LBMM01008226    KMQ89040.1    PTY24962.1    PTY23785.1    KU543682    AMS38369.1    ACPB03028300    LBMM01003366    KMQ93606.1    LBMM01005188    KMQ91737.1    LBMM01008445    KMQ88871.1    ABLF02011057    ABLF02048793    ABLF02020082    ABLF02020086    ABLF02020092    AAZX01006426    LBMM01008384    KMQ88925.1    KP771711    AKU04648.1    GECZ01013919    JAS55850.1    LBMM01004262    KMQ92649.1    ABLF02013358    ABLF02013361    ABLF02054869    KK114812    KFM63391.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00075   RNase_H
PF07530   PRE_C2HC
PF12017   Tnp_P_element
PF00098   zf-CCHC
PF01280   Ribosomal_L19e
PF00004   AAA
PF17862   AAA_lid_3
PF16725   Nucleolin_bd
PF16012   DUF4780
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR006579   Pre_C2HC_dom       
IPR021896   Transposase_37       
IPR039547   RPL19       
IPR000196   Ribosomal_L19/L19e       
IPR023638   Ribosomal_L19/L19e_CS       
IPR035970   60S_ribosomal_L19/L19e_sf       
IPR015972   Ribosomal_L19/L19e_dom1       
IPR033935   Ribosomal_L19_euka       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR031996   NVL2_nucleolin-bd       
IPR041569   AAA_lid_3       
IPR003593   AAA+_ATPase       
IPR038100   NLV2_N_sf       
IPR031961   DUF4780       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF48140   SSF48140       
SSF52540   SSF52540       
PDB
1WDU     E-value=1.13994e-29,     Score=324

Ontologies

Topology

Length:
455
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000710000000000001
Exp number, first 60 AAs:
0.00025
Total prob of N-in:
0.00309
outside
1  -  455
 
 

Population Genetic Test Statistics

Pi
21.013213
Theta
4.955533
Tajima's D
-1.251795
CLR
40.572289
CSRT
0.0889455527223639
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号