SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12855
Pre Gene Modal
BGIBMGA012668
Annotation
PREDICTED:_netrin_receptor_UNC5C-like_isoform_X1_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.986 Nuclear   Reliability : 1.583
 

Sequence

CDS
ATGGCGGGAGGGGTTGCGCTCCTCGTGCTATGGGTGGTCGCAGTCACAGCTGATGGTAAACACGACGTGTCAAACTCAACTGAAGCCGCAACGACAGCGTTTCCCACAGCACCCATACCACTGCGACCAGAATATGCTCATCCGGCTGGAGTAGAAGCATTAGACCCTTACAACTCAGAGAAGAACAACCCGCCAATTCATCACAAAGACTATTTAGAAGAAGACTACGACCATGAATCTCACAAAGAAGACGACCACGACAACAGAGACGATACAGAAGAATTACCTTCGCTATCAGGAGACCATTTGCTCCAAAGCGCGACGGATAATCTGCCAATGTTTCTATTAGAGCCACAACACGCGTTTGTTGTGAGAAATAAACCGGCCACGTTAAGATGTCGGGCGGCTAATGCACTCCAAGTGTATTTTAAGTGCAACGAAGTTCGATCGGTTGCGAGCACACAGTTCGAGTTCGTGGATCCCCAAAGCGGAGTTAGGATCGTTGAAGCCGAATGTAACGTGACGCGGGATCAGTTAGATGAATATTTCGGTGAGGACAGATTTACGTGCACTTGCTACGCTTGGAGCAGCAGAGGAGACATCCGAAGCCAGCCGGCTGTCGTGGAACTTGCCTATCTAAAGAAGCCATTCGCGGTATCGCCGTCAGCGATTTCAGTAGAGGCCGGTTCAGCCGCTTCTCTGCGCTGCTCTCCACCAATGGCTGCCCCACCTCCTCACATATCCTGGTTGAAGCACGGGGCCCCTCTGCAGCAGGATCACAACGTGCTGGTTTCTGCAGAAGGAAATCTGCTGATATCTCGTTCCACTTTGCAAGACATGGCAAACTACAGCTGCGTTGCTGAGAACATAGCCGGGAAGAGAATATCTGAGCCCGCTCTCCTAACTGTTTACGTGAACGGAGGGTGGAGTGCCTGGGGTCCCTGGACTCAGTGTCGTTGCAACGGCCGAATCTCGAGCGGGCAGCGTCGCACGAGGACCTGCACCGAACCTCATCCTCTCAACGGAGGAGCTCCGTGTCAAGGTCAGGCCGTGCAGAGGACCGCGGACTGCCTTCCGTGTCAAAGTGCACTCTCTGGACGATGGGGGGCTTGGTCGGAGTGGTCAGTGTGCGGTGCAGACTGCCGGCAGATCCGACGAAGATCTTGTACCGGCGATACGCCTTGTTCCGGGGCACACGCGCAACACGCCGATTGCGTTGGAGACTACTGTGGAGTTCATGGAGTTGCCGCGCACAGTGACATCCCTCTGTACATCGGAATCGCCGTCGCCGTGGTCGTATTCCTGGCTGGTGCTGCCGTGGTCTACAAACTGCTGCAGAGGAAGACCCGAGACCATTCTTTGTACACTATGACTAGGACAGATTTCCAACCAGAAATATACCCGACAGTGGAGAAGCAGTCCTTATCGCTAGCTCCTGATCTAATGCAGCACAGACCCCCAAGATACGAACATCCCCAACCCGAACATCACTATGATGTGCCACATCTAACGAACAGTTACGCTTCACCTGTGGACCACCAAGTGACTCCATCTGCCTCTACCAAGGGACAGAGCGACGATTATGAAAGCAAACCGTACAGCGAATCAGAACATTCAGCCTCTAGTTGTTTCACGAGCTCCGGTTCGATGTACGACGCGGCCAATGAATCCGTGACACTCCAACTGGCAGAGTTCGTCTCCAATTCGCCCACGTCACAATCCATGTCGGTCTCCAGTGCCGGAGCCAGACTGGCCTTGCCCGCAGCGGGGGTGGCCCTTTCAGTTCCTGAAGGAGCCCTGGCCAGGGGTAGACGAGAGCAGATCTATGTGGCTGTCGTCAAGGATGACAGATACAGGCCGCGACTCGGAAAAGGTATCACGCAGCTGAGTCCGGTGGTTAAATGCGGCCCGCCGCGTCAGACATTAAACAAGTCCGTCGTCTTACAAATACCACATTGCGCCAGCCTCAAGCATGGCTTCTGGAACCTGTCTCTGTACGCCATAGACCACAACAGTAAGCCAGAGGGCGGCCAGTCTCAGTGGAAGAAGATCGTGGGCCTCGGTCAAGAAACCATCAACACCCCAATCTTCACACAGCTCGACAACGACAAGATATTCCTTGTGACGGACATGTTGTCCACGTTCGTATTGGTCGGTGAAAGTTTCAATGGTAAGGCCGTAAAGGCACTACAATTAGCGATCTACGCCCCGACCGTGCTCAACGAAACCAGTTCCGAATATAGCATTAGATTGTACGTGTTCGAAGACACGCCTTGTGCGGCTTACTATTGTCAGGAACAAGAGAAAAAACTCGGCGGAGTGTTGCTTGAACGACCGAAAACTTTATTGTTCCAAGACGGAGGCTCCCATCTTTGTTTGAATCTGGAGCACGTCAGTCCCGGCTGGAAAGCGAAGCCGGGCATCGGTTATCAGGAGATCCCATTCAATCACGTGTGGAGCTCGAACTACAACGCTCTGCATTGCAGCTTCACTCTCGATCGGACGCACGACTGCGACAATATTGATTTTACGATCTCAGCCTGTCAGAGAACGAATCCATCTTATAAGCAAACGTTCAGGATATGCCTCGAAGACATGCAGAGTCGGTCGCCACGGGGCAGATCGCCGCGCGAATCCCAGCGCAGTTTTAATATTACCGAGAATCTCTTGGATGGTCGTATGGGTCGAAACGACGAGGGCAGTGAGGGTAGCGTGAAAAGAAACATCACTGTTAATGAGACGGGCGTGAACGAATGCTCCGGAGAGGGCCCTTTCAAATTGAGCGGGAAGATAAAAAGGCAGCTTTGTGCCATTTTAGACCCTCCTAACGCCCGTGGAAATGATTGGCGTGCTCTGGCATCGCGGTTGGGCGTAGATCGCTATACAACTTGGTTCGCCACAAAGAGCTCACCCACTGAAGCTATATTAGAGCTGTGGGAATGCAGGGAGCGTCATCCTGGGGCCATTCCCGCTCTGGCGACCGCATTGCGACAGATGGACAGACACGACGCCGCTGATCTACTTCATATACGGCCATCTTGGTTATGA
Protein
MAGGVALLVLWVVAVTADGKHDVSNSTEAATTAFPTAPIPLRPEYAHPAGVEALDPYNSEKNNPPIHHKDYLEEDYDHESHKEDDHDNRDDTEELPSLSGDHLLQSATDNLPMFLLEPQHAFVVRNKPATLRCRAANALQVYFKCNEVRSVASTQFEFVDPQSGVRIVEAECNVTRDQLDEYFGEDRFTCTCYAWSSRGDIRSQPAVVELAYLKKPFAVSPSAISVEAGSAASLRCSPPMAAPPPHISWLKHGAPLQQDHNVLVSAEGNLLISRSTLQDMANYSCVAENIAGKRISEPALLTVYVNGGWSAWGPWTQCRCNGRISSGQRRTRTCTEPHPLNGGAPCQGQAVQRTADCLPCQSALSGRWGAWSEWSVCGADCRQIRRRSCTGDTPCSGAHAQHADCVGDYCGVHGVAAHSDIPLYIGIAVAVVVFLAGAAVVYKLLQRKTRDHSLYTMTRTDFQPEIYPTVEKQSLSLAPDLMQHRPPRYEHPQPEHHYDVPHLTNSYASPVDHQVTPSASTKGQSDDYESKPYSESEHSASSCFTSSGSMYDAANESVTLQLAEFVSNSPTSQSMSVSSAGARLALPAAGVALSVPEGALARGRREQIYVAVVKDDRYRPRLGKGITQLSPVVKCGPPRQTLNKSVVLQIPHCASLKHGFWNLSLYAIDHNSKPEGGQSQWKKIVGLGQETINTPIFTQLDNDKIFLVTDMLSTFVLVGESFNGKAVKALQLAIYAPTVLNETSSEYSIRLYVFEDTPCAAYYCQEQEKKLGGVLLERPKTLLFQDGGSHLCLNLEHVSPGWKAKPGIGYQEIPFNHVWSSNYNALHCSFTLDRTHDCDNIDFTISACQRTNPSYKQTFRICLEDMQSRSPRGRSPRESQRSFNITENLLDGRMGRNDEGSEGSVKRNITVNETGVNECSGEGPFKLSGKIKRQLCAILDPPNARGNDWRALASRLGVDRYTTWFATKSSPTEAILELWECRERHPGAIPALATALRQMDRHDAADLLHIRPSWL

Summary

Similarity
Belongs to the serpin family.
EMBL
NWSH01001062    PCG72847.1    KZ149907    PZC78254.1    PCG72846.1    RSAL01000046    + More
RVE50538.1    AGBW02012107    OWR45646.1    KQ459324    KPJ01644.1    GEZM01086422    JAV59460.1    GEDC01031076    JAS06222.1    KK852508    KDR22415.1    GDHC01018809    GDHC01013807    JAP99819.1    JAQ04822.1    GBRD01002257    JAG63564.1    GBHO01043896    JAF99707.1    GEBQ01016935    JAT23042.1    KQ977642    KYN01011.1    GEBQ01024488    JAT15489.1    ADTU01025884    ADTU01025885    KQ980295    KYN16887.1    KK107847    EZA47459.1    KQ976625    KYM78959.1    QOIP01000005    RLU23184.1    KQ434870    KZC09610.1    NWSH01004342    PCG65211.1    KQ414585    KOC70552.1    KQ982585    KYQ54236.1    KZ150134    PZC73003.1    GL887491    EGI71002.1    AGBW02011206    OWR47055.1    GEDC01020737    JAS16561.1    KQ460874    KPJ11666.1    KQ435727    KOX77995.1    KQ459586    KPI98031.1    RSAL01000124    RVE46623.1    ABLF02041018    GL732534    EFX84751.1    GDIP01015914    JAM87801.1    GDIQ01162251    JAK89474.1    GDIP01188765    JAJ34637.1    GFXV01004337    MBW16142.1    JH430009    GDIQ01163557    JAK88168.1    GDIQ01168858    JAK82867.1    KQ971343    KYB27433.1    EZA47457.1    KYQ54241.1    KQ981979    KYN31545.1    GL441572    EFN64605.1    KB203683    ESO83456.1    KYN01006.1    EGI71006.1    KYN31539.1    RLU23185.1    GDIQ01187291    JAK64434.1    KYN16881.1    ADTU01018638    ADTU01018639    KYM78963.1    NEDP02001973    OWF52102.1    KZC09608.1    GGMS01000443    MBY69646.1    GDIP01115424    JAL88290.1    KQ414755    KOC61811.1    GAMC01015247    JAB91308.1    GAMC01015248    JAB91307.1    GBXI01007470    JAD06822.1    KOX77999.1    KZ288263    PBC30344.1    AERX01032132    CM012448    RVE65808.1    HAEA01013744    SBQ42224.1    HAEI01001394    SBR75986.1    HAEB01008131    HAEC01013243    SBQ81460.1    HAEH01010337    SBR89445.1    HAEE01002135    SBR22155.1   
Pfam
PF00531   Death        + More
PF07679   I-set
PF17217   UPA
PF00791   ZU5
PF00090   TSP_1
PF00079   Serpin
Interpro
IPR033772   UPA        + More
IPR013098   Ig_I-set       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR000488   Death_domain       
IPR013783   Ig-like_fold       
IPR011029   DEATH-like_dom_sf       
IPR000906   ZU5_dom       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR037936   UNC5       
IPR000884   TSP1_rpt       
IPR036383   TSP1_rpt_sf       
IPR042178   Serpin_sf_1       
IPR042185   Serpin_sf_2       
IPR023796   Serpin_dom       
IPR036186   Serpin_sf       
IPR042154   Death_UNC5C       
SUPFAM
SSF47986   SSF47986        + More
SSF82895   SSF82895       
SSF48726   SSF48726       
SSF56574   SSF56574       
PDB
3G5B     E-value=8.26336e-73,     Score=700

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.989115
 
 
Length:
1015
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
20.40881
Exp number, first 60 AAs:
0.02491
Total prob of N-in:
0.02915
outside
1  -  1015
 
 

Population Genetic Test Statistics

Pi
288.574485
Theta
187.358997
Tajima's D
1.655391
CLR
0.104521
CSRT
0.819059047047648
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号