SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12852
Pre Gene Modal
BGIBMGA010729
Annotation
retroelement_polyprotein_[Glyptapanteles_flavicoxis]
Location in the cell
Nuclear   Reliability : 2.524
 

Sequence

CDS
ATGGGTGACTGTGACACTGAATCTCGCTATTGTACTACTTTGACAGTTGAGTTTCCCGAAATTACGCTAGAAATAGACTTTCAAATTGTTAGTGACAAGTTCATGAATACCCCAGTCATAATCGGTACTGACGTTTTGAATCGGGAAGGTGTCACGTATATTAGGAAAAAGGGCATACAGCGCTTAACTCGGGTAGAAAAGGTTTTTACTGCGGAGACAACTGAACTTAATTCAATCCGTACCGTGAATACTTCATTAACAGGTGAAGAAAAAAATAAATTATTAGCTTTGGTACGAAAATTTTCAAAATACCTTATAACTGGTACCGCGGCCAGTACTGTTACAACTGGATCCATGCAAATTCGACTCAGCAATGAAACTCCTATTGTTTACAGACCTTACAAATTATCATTTAGCGAAAAACTTCGCGTTAGAGAAATTATTAAGGATCTTCTTGATAAAGGTGTGATTAGGGAGTCTGAATCGGAGTTCTCGAGTCCGATATTGCTAGTTAAGAAAAAGGACGGCAGTGACAGGATGTGCGTGGACTTTCGGGCTCTTAATGCGAATACTGTGAAGGATCGCTATCCATTGCCGTTAATAGACGATCACATTGACCGGTTAGGTAGCGCAAAATATTTTACAAGCCTCGATATGGCCACTGGTTTCCACCAGATTCCTTTAGCAAACGACTCCATTCACAAAACCGGCTTTGTGACACCCGAAGGTCATTTTGAATACCTTAAAATGCCCTACGGGTTAGCTAATGCCCCGGTTGTTTATCAACGTATTATAACTAATACTCTGAAAGCCTTTAGTGAGACAGGGAGGGCTTTAATCTATATCGATGATGTTTTAATACCTAGTCAGACCATTGATGAAGGCCTAAATACTCTGCGTGAAATCTTTGAAACACTAACTAAGGCGGGCTTCTCAATTAATTTAAAAAAATGCAAGTTTCTTGCTAACGAAATTGAATATTTGGGCAGAACTATCAGCAATGGTCAGGTTAGGCCGAGTACGTATAAAGTAGAAGCATTGACAAAAGCCCCGAAGCCTGGTAATGTTAAACAAGCTAGACAATTTTTAGGTCTAGCGGGTTATTTTCGGCGCTATATTCCTGCATATTCGTTGCAGACAGCTTGTATTTCTAATCTGTTTCGTAAAGGTGTTGAGTTTAAATGGGGTGATGAACAGGAACAAGTACGCCAGTATATAATTACGCGTTTAACCAGTGAACCTGTCCTCAATATATTTAATCCATCATTATTAACAGAAGTACACACTGATGCTTCTTCTCGAGGGTATGGAGCTGTTTTACTTCAGACTCATGGGAATAATAATAAACGCGTGGTGGGATATTTTAGTAAAGTTACCCAAGGCGCCGAACCACGCTATCACTCCTATGAGCTGGAGACACTCGCTGTGGTCAAGGCTCTGCAGCATTTCAGGCACTACCTCATAGGTATACATTTCAAGGTAGTTACAGACTGCAACGCTTTGAAGCTTACCCAACGTAAAAAAGATTTACTACCGAGAGTCGCTCGGTGGTGGATCTACTTACAAGATTATGATTTTTCGTTAGAGTATCGTAAGGGCGCTGTGCTATCTCATGCCGACTATCTAAGTCGTAATCCTATAAATGTTTGTGAAATTGGTAGACCGCATAACTGGGCACAGATAGCACAGAGTGCTGATGAAGAAACTCGGAATTTAATACAAAAGTTACAAAACGGTGAATTAGATGAGACACGCTATGTAACTAAAAATGATGTTCTTTATTATAAATTTGATTCTGTTGGCCAACCTAGTAAATTATTATGTTATATTCCAAGAGGACATCGCCTCAGTTTGTTACGAATCTTTCATGATGAGCATCATCATATTGGAGTAGATAAGACGCTTGATCTAATATTAAACCATTTTTGGTTTCCTAGTCTAAGACAATTTGTTCGTAAATATGTACGCCATTGTATAGTATGTCTTTCACACAAAAAAATACCACGTCAACCCTTGCAGCCGATCGAGTCGTGGAAGAAACCGGACGTACCCTTTGACACGGTACATAGTGATGTCTTGGGTCCTCTTCCCGAATCGAACGGTTACAAATTTGTTGTCTTGATAATTGACGCTTATAGTAAGTTCTGTCTACTAAATCCTATGCGTAAGCAGGATGCAACAGAGTTAAAATTAGTATTTGAAAACGCTGTATCTTTATTTGGTGCACCTAGGCAGATTGTAACCGATAGGGGTAGAATGTACGAAAATAGATCATTTAGACAATGGGTATCAGACGTAGGTAGTAATTTATTCTTTATAACGCCAGAGATGCACCAGAGTAACGGTCAGGCTGAGAGATATTGCAGAACAGTTCTTAATATGATTCGTGTGGAGGTAAATTTCAGAAACGAAAATTGGTCAGAAGTTTTGTGGAAACTGCAGCTCACCCTGAACATTACGAAACAAAAGTCCACTCAATATTCACCTTTATATTTGTTAATTGGTAGCGATGCTGTGACGCCCGTCATTCGTTCCGTTGTACGCGATGTGGCTCTAGAAGGAACAAGTGCCAACAGAGAAACCTTACGCGAGCTTGCCCGACAAAGAGCTTCTCAACTGCTGGACAAAAACCGAAAACAGCAGGACACTCGAGTAAATGAACGGCGCAAACCCCCGCGTACTTTCCATGAAAACGACGTGGTCTTCGTGCATAAGAATAGCCAATCTGTTGGAAAGCTGGATTCTGGTATGCGTGGCCCGTACAAAATAGTGCGTGCGCTGCCACATGGACGTTATGAACTGAAGCTTCTTTCTGGCTCACTTGGGAAGACCACGAAAGCTGCTGCCGAATTTATAAGTGATGAGAATAGCTCTGAGGAAGGTATTGTTGCCGGTCCATCACACCACCATGACGACATAGTACCTCTAGACGGACCTATTAATGCGGGCGAGGACGCTCCGCCGTCAGGAGAGGCCGTGTTAGAAGATGATGATGACATTGGAGGCGTGGCCTAA
Protein
MGDCDTESRYCTTLTVEFPEITLEIDFQIVSDKFMNTPVIIGTDVLNREGVTYIRKKGIQRLTRVEKVFTAETTELNSIRTVNTSLTGEEKNKLLALVRKFSKYLITGTAASTVTTGSMQIRLSNETPIVYRPYKLSFSEKLRVREIIKDLLDKGVIRESESEFSSPILLVKKKDGSDRMCVDFRALNANTVKDRYPLPLIDDHIDRLGSAKYFTSLDMATGFHQIPLANDSIHKTGFVTPEGHFEYLKMPYGLANAPVVYQRIITNTLKAFSETGRALIYIDDVLIPSQTIDEGLNTLREIFETLTKAGFSINLKKCKFLANEIEYLGRTISNGQVRPSTYKVEALTKAPKPGNVKQARQFLGLAGYFRRYIPAYSLQTACISNLFRKGVEFKWGDEQEQVRQYIITRLTSEPVLNIFNPSLLTEVHTDASSRGYGAVLLQTHGNNNKRVVGYFSKVTQGAEPRYHSYELETLAVVKALQHFRHYLIGIHFKVVTDCNALKLTQRKKDLLPRVARWWIYLQDYDFSLEYRKGAVLSHADYLSRNPINVCEIGRPHNWAQIAQSADEETRNLIQKLQNGELDETRYVTKNDVLYYKFDSVGQPSKLLCYIPRGHRLSLLRIFHDEHHHIGVDKTLDLILNHFWFPSLRQFVRKYVRHCIVCLSHKKIPRQPLQPIESWKKPDVPFDTVHSDVLGPLPESNGYKFVVLIIDAYSKFCLLNPMRKQDATELKLVFENAVSLFGAPRQIVTDRGRMYENRSFRQWVSDVGSNLFFITPEMHQSNGQAERYCRTVLNMIRVEVNFRNENWSEVLWKLQLTLNITKQKSTQYSPLYLLIGSDAVTPVIRSVVRDVALEGTSANRETLRELARQRASQLLDKNRKQQDTRVNERRKPPRTFHENDVVFVHKNSQSVGKLDSGMRGPYKIVRALPHGRYELKLLSGSLGKTTKAAAEFISDENSSEEGIVAGPSHHHDDIVPLDGPINAGEDAPPSGEAVLEDDDDIGGVA

Summary

EMBL
RSAL01000399    RVE41947.1    GBHO01030786    JAG12818.1    GDHC01004980    JAQ13649.1    + More
EF710649    ACE75273.1    LBMM01008871    KMQ88569.1    GBYB01013920    JAG83687.1    GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    KQ971338    KYB27887.1    KYB27888.1    RSAL01000274    RVE43148.1    KQ971345    EFA05054.2    KQ460883    KPJ11409.1    GEZM01007614    GEZM01007613    GEZM01007612    JAV95056.1    GEZM01089268    GEZM01089261    JAV57577.1    GEZM01089269    GEZM01089265    JAV57567.1    GEZM01007616    GEZM01007615    GEZM01007611    JAV95051.1    ABLF02008401    ABLF02008404    GEGO01004299    JAR91105.1    LBMM01005919    KMQ91095.1    GGMR01009949    MBY22568.1    KMQ91096.1    GEZM01033083    JAV84424.1    KQ971339    KYB27733.1    LBMM01010976    KMQ87102.1    GGMR01016004    MBY28623.1    ABLF02004401    ABLF02013544    ABLF02013550    ABLF02033943    ABLF02042737    GGMR01003388    MBY16007.1    GFXV01005120    MBW16925.1    ABLF02041876    ABLF02004526    ABLF02054969    GEHC01000888    JAV46757.1    LBMM01011782    KMQ86633.1    GEZM01034557    JAV83728.1    GAMC01007326    JAB99229.1    GGMR01005091    MBY17710.1    ABLF02022032    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    X14037    CAA32198.1    GAMC01015907    JAB90648.1    IAAA01004057    LAA02040.1    IAAA01004058    LAA02042.1    IAAA01004056    LAA02037.1    GAKP01001563    JAC57389.1    GEZM01005427    JAV96179.1    ABLF02005846    GBXI01005773    JAD08519.1    GBXI01004632    JAD09660.1    GBBI01004551    JAC14161.1    GAKP01016237    JAC42715.1    GBBI01004550    JAC14162.1    ABLF02014660    ABLF02042774    GGMR01015682    MBY28301.1    GGMS01012726    MBY81929.1    GBBI01004477    JAC14235.1    GEHC01000930    JAV46715.1    GAKP01014483    JAC44469.1    GAKP01016235    JAC42717.1    GAMC01020207    JAB86348.1    GFTR01008753    JAW07673.1    GEHC01000880    JAV46765.1    GGMS01008442    MBY77645.1    GAKP01008942    JAC50010.1    ABLF02017401    GEZM01051217    GEZM01051215    JAV75083.1    GBXI01015151    JAC99140.1    GEHC01000891    JAV46754.1    GGMS01015422    MBY84625.1    KQ971370    KYB25610.1    KYB25609.1    NWSH01002797    PCG67520.1    KA649989    AFP64618.1    ABLF02005127    ABLF02005129    ABLF02007401    GGMR01018192    MBY30811.1    GEHC01000876    JAV46769.1    X95908    CAA65152.1    GFJQ02004121    JAW02849.1    GEGO01001472    JAR93932.1    GACK01009547    JAA55487.1    GEFM01006999    JAP68797.1    GAKP01019383    JAC39569.1    GGFK01007168    MBW40489.1    GBBI01004613    JAC14099.1    GBBI01004549    JAC14163.1    GBHO01015604    JAG28000.1    GGFK01005990    MBW39311.1    GACK01004001    JAA61033.1    GACK01009195    JAA55839.1    ABLF02023666   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF00077   RVP
PF00098   zf-CCHC
PF17917   RT_RNaseH
PF14392   zf-CCHC_4
PF13873   Myb_DNA-bind_5
PF02037   SAP
PF03732   Retrotrans_gag
PF16064   DUF4806
PF12384   Peptidase_A2B
PF09668   Asp_protease
PF07530   PRE_C2HC
PF03273   Baculo_gp64
Interpro
IPR000477   RT_dom        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
IPR034122   Retropepsin-like_bacterial       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR028002   Myb_DNA-bind_5       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR005162   Retrotrans_gag_dom       
IPR032071   DUF4806       
IPR024650   Peptidase_A2B       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR004955   Baculovirus_Gp64       
IPR006579   Pre_C2HC_dom       
IPR011764   Biotin_carboxylation_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=2.37135e-77,     Score=739

Ontologies

Topology

Length:
1004
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.253340000000001
Exp number, first 60 AAs:
0.00117
Total prob of N-in:
0.01195
outside
1  -  1004
 
 

Population Genetic Test Statistics

Pi
2.530243
Theta
157.463951
Tajima's D
0
CLR
0
CSRT
0.371181440927954
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号