SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12840
Pre Gene Modal
BGIBMGA012722
Annotation
PREDICTED:_esterase_FE4-like_[Bombyx_mori]
Full name
Carboxylic ester hydrolase      
Location in the cell
Cytoplasmic   Reliability : 1.052 PlasmaMembrane   Reliability : 1.425
 

Sequence

CDS
ATGCTACGACCAGTGACTCTAGCGGTGGTCGTGGTCGCCTTGTTGTCGGCGGCGGGGGCGAGGCTGAGAGTAGACCCGCTCGTTGAGACCCGGAAGGGACTCATCAAGGGTCTTAGGTCCGAAAATGGAGAGTTCTCCAAGTTCCTGGGTGTGCCCTACGCGTTAGTAGACGAGGATAATCCTTTTGGGTCCTCAGTGCCGCACCCCGGCTTCGAGGAGACATTCGAGGCGTTCGACGATTCCGTGGTTTGTCCTCAACTCACCGACAATGTCGCGGTCGGAAGCCTCCAGTGCTTGAACCTGAACATCTACGTGCCCAACACGGCGACGTCGCGGAATAAGCGCCCGGTGATGATTTGGATCCACGGAGGGGGCTTCATGTCTGGCAGCGGAACTAGCAGAGATTACTCCTTCGAAGATCTGGTCCGACATGACGTTATCATTGTGTCGGTTAACTACCGGCTTGGAGCGTTTGGATTCTTTTGTTTGGACAGCGCCGATGTTCCTGGGAATCAGGGGTTGAAGGACCAAGTTCTTGCTTTAAAATGGATCAAGGAAAATATCGAGGCTTTCGGGGGAGATACCTCTAAGATAACTCTGTTCGGGGAAAGTGCGGGAGGCGTCGCCGTCGAGCTACACCTACTAACCGAGCAAGAGAAGTTCTTCAACCAGGTCATCGTTCAGAGCGCATCCGCCTTTATTCCTGGAGCCATCATGAAACCTGACAACAGTATCCCGATACGAATAGCCAGCCGATTGGGATTCGAAACTGACAACTTCGTAGAAGCTATAGCGTTTTTAGCCGATCAAGACCCGCTCCTGGTGGTCGGAGCGACTAGATCTGATGGCCCGGTCACTTTGACGGACGCCACCTTCGGCTTGTTCAGAGCTTGTATCGAAAATGAATATAATGGAGTTTATAGATTTCTTGCTAATACTCCAGAAAATTTAGACCCTAAAAAGCTTCGCAATATTCCGGTTATCTACGGAATGAACGATCGAGAAATGCTAACTCTGCACGCCTTGATCAGCCCGGAAGAATATGAGCAGCCGGCCATTAGAAACTACATGAATATAGCTTTCGACTTGAAGGAGAACGAGATAGAAGAAGACGTAACTCATTTCTACATCGCAGACGAACCCTTCAATCCGGAGGTCTTTGATAAATTCATTAATTTTGCTTCAAACTACTACTTTCATTATCCCGTCGAGCGGTCCCTTAAGAAGATATTGAACGCGGGCAACGAAGACATATATTACTATGTATTCTCGTACGATGGCGGTCGAAACGCTATGAAAAACCATCTTGGAATAACAGCGCCGGGCGCGGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGACTTGCAGCCGGGTGAGCTTGTTGCGGAGGAGGATCAACTAGTCATTGACAGAATCACTACGCTTTGGACCAATTTTGCTAAGTTCGGCAATCCGACCCCTGAAACATCTGACCTGCTGCCAGTCGTGTGGTCGCCAGTGACGGCGAGCAGGCGGCCCTTCCTGGAGATCGGCGCCGACTTCGGACTCAAGAGCAGGCCTTTCCACGACCGCATGGCCTTCTGGGATCTCTTCTACAAGCTGTATGGAAAACTGGAACGCATTCACTAA
Protein
MLRPVTLAVVVVALLSAAGARLRVDPLVETRKGLIKGLRSENGEFSKFLGVPYALVDEDNPFGSSVPHPGFEETFEAFDDSVVCPQLTDNVAVGSLQCLNLNIYVPNTATSRNKRPVMIWIHGGGFMSGSGTSRDYSFEDLVRHDVIIVSVNYRLGAFGFFCLDSADVPGNQGLKDQVLALKWIKENIEAFGGDTSKITLFGESAGGVAVELHLLTEQEKFFNQVIVQSASAFIPGAIMKPDNSIPIRIASRLGFETDNFVEAIAFLADQDPLLVVGATRSDGPVTLTDATFGLFRACIENEYNGVYRFLANTPENLDPKKLRNIPVIYGMNDREMLTLHALISPEEYEQPAIRNYMNIAFDLKENEIEEDVTHFYIADEPFNPEVFDKFINFASNYYFHYPVERSLKKILNAGNEDIYYYVFSYDGGRNAMKNHLGITAPGAAHADELGYLLAVDLQPGELVAEEDQLVIDRITTLWTNFAKFGNPTPETSDLLPVVWSPVTASRRPFLEIGADFGLKSRPFHDRMAFWDLFYKLYGKLERIH

Summary

Similarity
Belongs to the type-B carboxylesterase/lipase family.
Feature
chain  Carboxylic ester hydrolase
EC Number
3.1.1.-
EMBL
BABH01018991    BABH01018992    BABH01019018    BABH01018995    BABH01018984    BABH01018985    + More
ODYU01001845    SOQ38611.1    SOQ38612.1    NWSH01000660    PCG74962.1    KZ149903    PZC78410.1    SOQ38610.1    SOQ38609.1    BABH01021273    KQ460400    KPJ14974.1    SOQ38608.1    KQ459564    KPI99621.1    SOQ38607.1    NWSH01000356    PCG77070.1    KY021858    AQY62747.1    NWSH01000067    PCG79999.1    KQ459606    KPI91074.1    PCG77069.1    FJ997307    ADF43472.1    KPI99620.1    SOQ38604.1    ODYU01010533    SOQ55708.1    AGBW02008309    OWR53771.1    EU523532    ACB12411.1    KZ150007    PZC75160.1    KPI99618.1    ODYU01001525    SOQ37859.1    FJ997304    ADF43469.1    BABH01001500    BABH01007753    KQ459837    KPJ19757.1    JTDY01001549    KOB73566.1    EU523536    ACB12415.1    KC200270    AGG20205.1    RSAL01000314    RVE42639.1    JTDY01003780    KOB69017.1    KY021842    AQY62731.1    SOQ38605.1    KY304479    AUN86410.1    NWSH01000834    PCG73942.1    KPI91073.1    KPI99616.1    PZC78409.1    KPI91075.1    KPJ19760.1    FJ997305    ADF43470.1    FJ997306    ADF43471.1    MG846884    AXY94736.1    KY021841    AQY62730.1    KZ150132    PZC73036.1    SOQ38606.1    PCG74961.1    KQ460205    KPJ17125.1    ODYU01008680    SOQ52463.1    KY021848    AQY62737.1    OWR53772.1    NWSH01001418    PCG71299.1    EU688968    ACD80422.1    SOQ38613.1    PZC78412.1    PZC78414.1    KJ023212    AIY69040.1    SOQ37858.1    KY021850    AQY62739.1    RSAL01000258    RVE43396.1    PZC78411.1    PCG74959.1    PCG74960.1    OWR53773.1    JTDY01003106    KOB70142.1    ODYU01006598    SOQ48575.1    RVE43394.1    JTDY01003509    KOB69443.1    KU375432    APD13874.1    FJ652455    ACV60239.1    KY021887    AQY62776.1    BABH01001182    KC200271    AGG20206.1    KP001149    AJN91194.1    KQ460947    KPJ10567.1    BABH01003066    EU523534    ACB12413.2    DQ680829    ABH01082.1    KPI91162.1    FJ556877    ACL83460.1    FJ997308    ADF43473.1    JTDY01004572    KOB67996.1    PCG74963.1    JTDY01007420    KOB65210.1    KZ149946    PZC76749.1    LC017770    BAR64784.1    BABH01026894    ODYU01002500    SOQ40071.1    KY021884    AQY62773.1    NWSH01002285    PCG68674.1    KP001158    AJN91203.2    HM150791    ADI47117.1    ODYU01002878    SOQ40908.1    JTDY01000638    KOB76381.1   
Pfam
PF00135   COesterase
Interpro
IPR002018   CarbesteraseB        + More
IPR019826   Carboxylesterase_B_AS       
IPR002168   Lipase_GDXG_HIS_AS       
IPR029058   AB_hydrolase       
IPR000997   Cholinesterase       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
5YDJ     E-value=8.50898e-46,     Score=464

Ontologies

Topology

SignalP
Position:   1 - 20,         Likelihood:  0.966649
 
 
Length:
544
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.33693999999999
Exp number, first 60 AAs:
6.29157
Total prob of N-in:
0.32811
outside
1  -  544
 
 

Population Genetic Test Statistics

Pi
208.11696
Theta
176.665756
Tajima's D
0.669794
CLR
3.281597
CSRT
0.565671716414179
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号