SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12839
Pre Gene Modal
BGIBMGA012722
Annotation
PREDICTED:_esterase_FE4-like_[Bombyx_mori]
Full name
Carboxylic ester hydrolase      
Location in the cell
Cytoplasmic   Reliability : 1.051 PlasmaMembrane   Reliability : 1.592
 

Sequence

CDS
ATGCTACGACCAGTGACTCTAGCGGTGGTCGTGGTCGCCTTGTTGTCGGCGGCGGGGGCGAGGCTCAGAGTAGACCCGCTCGTTGAGACCCGGAAGGGACTCATCAAGGGTCTTAGGTCCGAAAATGGAGAGTTCTCCAAGTTCCTGGGTGTGCCCTACGCGTTAGTAGACGAGGATAATCCTTTTGGGTCCTCAGTGCCGCACCCCGGCTTCGAGGAGATATTCGAGGCGTTCGACGATTCCGTGGTTTGTCCTCAACTCACCGACAATGTCGCGGTCGGAAGCCTCCAGTGCTTGAACCTGAACATCTACGTGCCCAACACGGCAACGTCGCGGAATAAGCGCCCGGTGATGATTTGGATCCACGGAGGGGGCTTCATGTCCGGCAGCGGAACTAGCAGAGATTACTCCTTCGAAGATCTGGTCCGACATGACGTTATCATTGTGTCGGTTAACTACCGGCTTGGAGCGTTTGGATTCTTTTGTTTGGACAGCGCCGATGTTCCTGGGAATCAGGGGTTGAAGGACCAAGTTCTTGCTTTAAAATGGATCAAGGAAAATATCGAGGCTTTCGGGGGAGATACCTCTAAGATAACTCTGTTCGGGGAAAGTGCGGGAGGCGTCGCCGTCGAGCTACACCTACTAACAGAGCAAGAGAAGTTCTTCAATCGGGCCATCATTCAGAGCGGATCTGTCTTTATTCCTGGAGCCATCACGAAACCTGACAACAGTATCCCGATACGAATGGCCAGCCGATTGGGATTCGAAACTGACAATTTCGTAGAAGCTATAGCGTTTTTAGCCGATCAAGACCCGCTCCTGGTGGTCGAAGCGACTAAATCTGATGGCCCGGTCACTTTGACGGACGCCACCTTCGGCTCGTTCACAGCTTGTATCGAAAATGAATATAATGGAGTTTATAGATTTCTTGCTAATGCTCCAGAAAATATAGACCCTAAAAAGCTTCGCAATATTCCGGTTATCTACGGAGTGAACGATCATGAAATGCTAATTCTGCATGCCTTCATCAGCCCAGAGCAGTATGAGCAGCCGGCCATTAGAAACTACATGAAAATAGCTTTCGACTTGAAGGAGAACGAGATAGAAGAAGACGTAACTCATTTCTACATCGCAGACGAACCCTTCAATCCGGAGGTCTTTGATAAATTCATTAATTTTGCTTCAAACTACCTCTTTAATTATCCCGTCGAGCGGTCCCTTAAGAAGATATTGAGCGCGGGCAACGAAGACATATATTACTATGTATTCTCGTACGATGGCGGTCGAAACGTTATGAAGAAACATCTTGGAATAACAGCGCCGGGCGCGGCGCATGCGGACGAGCTCGGCTACCTGCTGGCCGTGGACTTGCAGCCGGGCGAGCTTGTTGCGGAGGAGGATCAACTAGTCATCGACAGAATCACTACGCTTTGGACCAATTTTGCTAAATTCGGCAATCCGACCCCTGAAACATCTGACCTGCTGCCAGTCGTGTGGTCACCAGTGACGGCGAGCAGGCGGCCCTTCCTGGAGATCGGCGCCGACTTCGGACTCAAGAGCAGGCCTTTCCACGACCGCATGGCCTTCTGGGATCTCTTCTACAAGCTGTATGGAAAACTGGAACGCATTCACTAA
Protein
MLRPVTLAVVVVALLSAAGARLRVDPLVETRKGLIKGLRSENGEFSKFLGVPYALVDEDNPFGSSVPHPGFEEIFEAFDDSVVCPQLTDNVAVGSLQCLNLNIYVPNTATSRNKRPVMIWIHGGGFMSGSGTSRDYSFEDLVRHDVIIVSVNYRLGAFGFFCLDSADVPGNQGLKDQVLALKWIKENIEAFGGDTSKITLFGESAGGVAVELHLLTEQEKFFNRAIIQSGSVFIPGAITKPDNSIPIRMASRLGFETDNFVEAIAFLADQDPLLVVEATKSDGPVTLTDATFGSFTACIENEYNGVYRFLANAPENIDPKKLRNIPVIYGVNDHEMLILHAFISPEQYEQPAIRNYMKIAFDLKENEIEEDVTHFYIADEPFNPEVFDKFINFASNYLFNYPVERSLKKILSAGNEDIYYYVFSYDGGRNVMKKHLGITAPGAAHADELGYLLAVDLQPGELVAEEDQLVIDRITTLWTNFAKFGNPTPETSDLLPVVWSPVTASRRPFLEIGADFGLKSRPFHDRMAFWDLFYKLYGKLERIH

Summary

Similarity
Belongs to the type-B carboxylesterase/lipase family.
Feature
chain  Carboxylic ester hydrolase
EC Number
3.1.1.-
EMBL
BABH01019018    BABH01018991    BABH01018992    BABH01018995    BABH01018984    BABH01018985    + More
ODYU01001845    SOQ38611.1    SOQ38612.1    SOQ38609.1    SOQ38610.1    NWSH01000660    PCG74962.1    KZ149903    PZC78410.1    SOQ38607.1    BABH01021273    SOQ38608.1    KQ460400    KPJ14974.1    KQ459564    KPI99621.1    NWSH01000067    PCG79999.1    KY021858    AQY62747.1    NWSH01000356    PCG77070.1    SOQ38604.1    KQ459606    KPI91074.1    FJ997307    ADF43472.1    PCG77069.1    SOQ38605.1    KPI99620.1    BABH01007753    ODYU01010533    SOQ55708.1    EU523532    ACB12411.1    AGBW02008309    OWR53771.1    BABH01001500    ODYU01001525    SOQ37859.1    KQ459837    KPJ19757.1    KPI99618.1    KZ150007    PZC75160.1    FJ997304    ADF43469.1    KC200270    AGG20205.1    EU523536    ACB12415.1    PZC78409.1    RSAL01000314    RVE42639.1    FJ997306    ADF43471.1    KPI91073.1    FJ997305    ADF43470.1    NWSH01000834    PCG73942.1    JTDY01003780    KOB69017.1    KPI91075.1    KY304479    AUN86410.1    KY021842    AQY62731.1    JTDY01001549    KOB73566.1    KPI99616.1    KPJ19760.1    SOQ38606.1    KY021848    AQY62737.1    KY021841    AQY62730.1    PCG74961.1    MG846884    AXY94736.1    KQ460205    KPJ17125.1    ODYU01008680    SOQ52463.1    OWR53772.1    KZ150132    PZC73036.1    EU688968    ACD80422.1    SOQ38613.1    PZC78414.1    NWSH01001418    PCG71299.1    PZC78412.1    KJ023212    AIY69040.1    KY021850    AQY62739.1    RSAL01000258    RVE43396.1    PZC78411.1    SOQ37858.1    PCG74959.1    PCG74960.1    OWR53773.1    RVE43394.1    ODYU01006598    SOQ48575.1    JTDY01003106    KOB70142.1    JTDY01003509    KOB69443.1    KY021887    AQY62776.1    KU375432    APD13874.1    PCG74963.1    FJ652455    ACV60239.1    BABH01001182    KC200271    AGG20206.1    DQ680829    ABH01082.1    JTDY01007420    KOB65210.1    KQ460947    KPJ10567.1    JTDY01004572    KOB67996.1    KPI91162.1    FJ997308    ADF43473.1    BABH01026894    BABH01003066    EU523534    ACB12413.2    FJ556877    ACL83460.1    KP001149    AJN91194.1    KZ149946    PZC76749.1    NWSH01002285    PCG68674.1    HM150791    ADI47117.1    KY021884    AQY62773.1    ODYU01002500    SOQ40071.1    ODYU01002878    SOQ40908.1    KZ150117    PZC73246.1    MF687628    ATJ44554.1    MF687561    ATJ44487.1   
Pfam
PF00135   COesterase
Interpro
IPR029058   AB_hydrolase        + More
IPR002018   CarbesteraseB       
IPR019826   Carboxylesterase_B_AS       
IPR002168   Lipase_GDXG_HIS_AS       
IPR000997   Cholinesterase       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
6EMI     E-value=2.02587e-46,     Score=470

Ontologies

Topology

SignalP
Position:   1 - 20,         Likelihood:  0.966649
 
 
Length:
544
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.33873999999997
Exp number, first 60 AAs:
6.29217
Total prob of N-in:
0.32809
outside
1  -  544
 
 

Population Genetic Test Statistics

Pi
195.469076
Theta
193.102417
Tajima's D
1.384385
CLR
0.728557
CSRT
0.76111194440278
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号