SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12830
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.055
 

Sequence

CDS
ATGGCTACCAACTACCTTATCAATGTGCCGAAACTAAAAGGACGCGATAATTATTCAGAGTGGTGTTTCGCTGCAGAAAATTTTTTAGTACTCGAAGGCATGAAGCATTGCATCAAGCCAGAACCGGGGAAAGAAATAGCAAGCGCGGATGACGAAAAAACTAAAGCCAAATTGATCATGACCATCGACCCGTCGTTGTATGTACATGTCAAAACCGTTAAATCGTCGAAGGAATTGTGGGATAAACTAAGGCAATTATTCGATGATAGTGGCTTTTCACGAAGAATTAGTCTATTGAGAAATTTAATTTCAATCCGGCGAGATAATTGCAGTTCGATGACGTCATACGTGACGCAGATAATCGATACAGCGCAGAAATTAAGTGGAACGGGATTTGAAATAAACGAGGAATGGGTGGGATCATTGCTGTTGGCGGGGCTGCCAGAAAAGTTTGCCCCAATGATCATGGCAATTGAACATTCCGGGATTGCCATAAACTCTGATGTAATTAAAACAAAATTACTTGATATGAGTTCCGAGATCGGTGACCATGATCCGGAAGTTGCACTATGGTCGAAACCAAAAACGAGGGTAGATCAAAATTTCAATACAAAAGGCGAGAAACGAACATCAAATTATACGTCAAATGTAAAAAAAAAGGTTATAAAATGCTATAAATGTAAGCAAAGTGGTCATTATAAAAATCAGTGTCCGAGTTTAGAAGCCGAAAAAAGAAAACAATCCAACGCCTTTAGTGCTATTTTCTTAAGTGGAAATTTCAACTGCGATAGTTGGTACATAGATAGCGGGGCCAGCAAACACATGACAGCAAAGAAAGAATACGTTGAGAGTCCATCATTTGAACATGAAATTAAAGAAATAATTGTGGCGAACAAAACATCCGTCCCGGTAGTGTGTTCTGGTGATGTAAACATAATCACAGTTGTGAATGGTGTAGAATATGACATCACAGTTTCAAATGTATTGTGCATACCGAGTTTAACAACAAACTTGCTTTCAGTGAGTCAGTTGATTGAGAATGGCAATAAGGTAATCTTTAAAGAGAAATTTTGCTATATTTACAATCAACAGAGAACTCTAGTTGGAAAGGCAGAATTAGTAGATGGTGTGTACAGATTATATACTAAGAAATCAGAACAGTTATTCGCAGCCACAGCTAAGGTGTCGAGTGAAACATGGCATCGACGATTAGGGCATATCAACAGTACCAGCTTGAACAAAATGAAGAATGGAGCTACGACAGGTATTTCATACACAAATAAAGCTGATGTTGACAAATCTAAGTGTACTGTTTGCTGTAAGGGGAAGCAGGCTAGACTACCTTTTCAGCCTAGTTCAACTAGCACCCAAGATATTTTAGAATTGATACACTCAGATGTGTGTGGTCCGATGGAAAATGTGTCTATTGGAGGTTCCAGATACTATGTCTTATTTGTGGATGACTACAGCAGAATGGTTTTTGTATACTTCATGAAAACAAAGTCAGAGGTATTTAAGTTTTTCAAAGAATTCCAGTCACTTGTAGAAAAACAGACAGATCGGAAAATTAAAATTCTAAGAACAGACAATGGCGGTGAGTACTGCAGTCAAGACTTTGAAAGATATCTAAAACAACACGGAATAATTCACCAGAAAAGTAATGCTTACACACCACAGCAAAATGGTGTGTGTGAAAGGATGAATAGGTCATTAGTTGAAAAGGCTAGATGTCTAATTTTTGATGCTGGTTTACATAAAAAGTTTTGGGCAGAAGCCATAAATACCTCTGTATACTTAAGGAATCGATCAGTTGTTACTGGATTAAACAACATGACTCCATATGAAGCCTGGACAAAGAAAAAACCTGACTTAAGTCATGTACGTATTTTTGGAAGTAAGGTTATGATGCACATACCAAAAGAAAAGCGCTTAAAATGGGATATGAAGGCTAAAGAACTTATTTTGGTAGGCTATGCAGACAATGTAAAAGGCTATAGGGTTTATAACCCAGAAAATAACTCTGTCACAACTAGCAGAGACATTATAATAATGGAGAAAACCGAAAATACAATTGAAATTCCTATTGAGTGCAAGGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGATGATAATGATATCACATATATTCCAGAAGCTTCTTCAGTAAGTGACTCATATGACAGTTTTTCTGAAACAGCATCAGAACCAGAACCTTCATTATTAGAATTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTAGCTATAGCCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCCGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGGTATTTAAAATCTAAGTATGAACCGTGTTTGTTTACGAAGTCTGAAGGAAATGCTAAAGTTATAATAGCATTGTTTGTTGATGATTTTTTTGTTTTGCTAACTGTAAAATGGCAACTAATCAGTTAA
Protein
MATNYLINVPKLKGRDNYSEWCFAAENFLVLEGMKHCIKPEPGKEIASADDEKTKAKLIMTIDPSLYVHVKTVKSSKELWDKLRQLFDDSGFSRRISLLRNLISIRRDNCSSMTSYVTQIIDTAQKLSGTGFEINEEWVGSLLLAGLPEKFAPMIMAIEHSGIAINSDVIKTKLLDMSSEIGDHDPEVALWSKPKTRVDQNFNTKGEKRTSNYTSNVKKKVIKCYKCKQSGHYKNQCPSLEAEKRKQSNAFSAIFLSGNFNCDSWYIDSGASKHMTAKKEYVESPSFEHEIKEIIVANKTSVPVVCSGDVNIITVVNGVEYDITVSNVLCIPSLTTNLLSVSQLIENGNKVIFKEKFCYIYNQQRTLVGKAELVDGVYRLYTKKSEQLFAATAKVSSETWHRRLGHINSTSLNKMKNGATTGISYTNKADVDKSKCTVCCKGKQARLPFQPSSTSTQDILELIHSDVCGPMENVSIGGSRYYVLFVDDYSRMVFVYFMKTKSEVFKFFKEFQSLVEKQTDRKIKILRTDNGGEYCSQDFERYLKQHGIIHQKSNAYTPQQNGVCERMNRSLVEKARCLIFDAGLHKKFWAEAINTSVYLRNRSVVTGLNNMTPYEAWTKKKPDLSHVRIFGSKVMMHIPKEKRLKWDMKAKELILVGYADNVKGYRVYNPENNSVTTSRDIIIMEKTENTIEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSVSDSYDSFSETASEPEPSLLELNQDIPNKRVRKIPDRFSYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVPCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSKYEPCLFTKSEGNAKVIIALFVDDFFVLLTVKWQLIS

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
AGBW02009826    OWR49812.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    + More
GALX01001351    JAB67115.1    NWSH01002292    PCG68657.1    PCG68658.1    NWSH01000816    PCG74073.1    GEZM01011858    GEZM01011854    JAV93389.1    LBMM01004924    KMQ91985.1    GEZM01011855    JAV93396.1    KQ459875    KPJ19636.1    GEZM01011859    JAV93384.1    GBXI01011094    JAD03198.1    KQ460882    KPJ11482.1    GBHO01033237    JAG10367.1    GBHO01033235    JAG10369.1    GAKP01015352    JAC43600.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    JYDH01000330    KRY26802.1    JYDT01000069    KRY86576.1    JYDJ01000136    KRX42725.1    JYDJ01000808    KRX33413.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    NEVH01019375    PNF22597.1    NEVH01002725    PNF41351.1    GEDC01002834    JAS34464.1    KL367628    KFD61291.1    NEVH01006980    PNF36330.1    NEVH01006721    PNF37230.1    KL367553    KFD64618.1    DNYX01000353    HBK84078.1    GDHF01030254    JAI22060.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    GBXI01002679    JAD11613.1    GEZM01045163    GEZM01045162    JAV77888.1    LBMM01008124    KMQ89126.1    GANO01000510    JAB59361.1    GAMC01008189    JAB98366.1    KL367691    KFD60150.1    GAMC01020352    JAB86203.1    JYDQ01000379    KRY07987.1    LBMM01012645    KMQ86082.1    GEHC01000989    JAV46656.1    GAMC01020355    JAB86200.1    GEHC01000988    JAV46657.1    JYDU01000001    KRY01876.1    JYDL01000068    KRX18751.1    KA648745    AFP63374.1    LBMM01008999    LBMM01007721    KMQ88472.1    KMQ89488.1    GBXI01007143    JAD07149.1    GFTR01008662    JAW07764.1    GBHO01020706    JAG22898.1    GGFL01004951    MBW69129.1    KL367480    KFD71809.1    KL367527    KFD66146.1    GGFM01000952    MBW21703.1    GGFM01000953    MBW21704.1    CM007900    OTG06758.1    GDHF01029191    JAI23123.1    JYDN01000113    KRX56900.1    JYDM01000185    KRZ84108.1    CM003610    KYP61490.1    KRY26801.1    JYDP01000258    KRZ01816.1    GANO01000659    JAB59212.1    GDHF01029905    JAI22409.1    GDHF01000873    JAI51441.1    GEFH01000951    JAP67630.1    X13777    JYDO01000104    KRZ71003.1    KQ483843    KYP40337.1    QGNW01000068    RVX02815.1    GAMC01020736    JAB85819.1    GFTR01008771    JAW07655.1    NCKU01012701    RWS00004.1    GDUN01000695    JAN95224.1    CM003608    KYP66486.1    GDHF01029405    JAI22909.1    OIVN01006239    SPD28653.1    NKQK01000002    PSS35035.1    OIVN01000423    SPC79931.1    ASHM01014005    PNX95963.1    ASHM01014140    PNX96091.1    KL367637    KFD61067.1    GEZM01096003    JAV55208.1    GEZM01096000    JAV55213.1    D83003    BAA11674.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF14244   Retrotran_gag_3
PF04500   FLYWCH
PF05380   Peptidase_A17
PF00078   RVT_1
PF05585   DUF1758
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR029472   Copia-like_N       
IPR007588   Znf_FLYWCH       
IPR008042   Retrotrans_Pao       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
4NYF     E-value=0.0294741,     Score=91

Ontologies

Topology

Length:
1000
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.25418
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.00018
outside
1  -  1000
 
 

Population Genetic Test Statistics

Pi
165.685223
Theta
126.359502
Tajima's D
0.36578
CLR
113.694797
CSRT
0.474776261186941
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号