SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12825
Pre Gene Modal
BGIBMGA010007
Annotation
putative_DNA_helicase_[Cotesia_vestalis_bracovirus]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 1.79
 

Sequence

CDS
ATGGGCAACATGGAAGAACAACTTGATCGACGCCTAGAGATCAATGCAGGAATGAAGCGAGCAATTCTTCAAGACTTGCAGTGTCTGCTTCATGAACATCATGCGTTGGTCAGGTTGTTTAAGAGTGCTTTAGAGCGCATGCCAAGTGATGACTATAAAGTTGTTATCAAAGCAGATAAACGACCATCTGGAACACACGAAAGGACATTTAATGCTCCAACAGTAGACGAAGTTGCCATCCTGATTGTTGGTGAAAAATTGGAAAAACGCGATATTGTGCTTACACGTCGCGATACTGGGCAACTGCAACAAATATCTGAAACTCATCGATCATATGACACATTGCAATACCCGCTGATGTTTTGGCAAGGAGAAGATGGATATTATTTTAATATTAAAATGAAAAATCCATTGAATGGTGAAGAAACTACAAAGAAAGTTAGCTCAATGAATTATTACGCATATCGTTTGATGATTCGTCAAAATGCTGACAACTATTTGCTGCGGTTTCGTCGATTGTTTCAGCAGTATTGCGTTGACATGTATGTAAAAATAGAAACGGAACGTTTAACATTCATTAGGTTGAACCAAGCCAAACTGCGTTCTGAGGAATACATCCATTTACGTGATGCAGTTAGTACTGAAGGAAATGCAGCTAATATTGGTCGATTAACTATTCTGCCGGCGACATACATTGGTAGTCCACGTCATATGCATGAATATGCACAAGATGCAATGACATATGTTCGTCATTACGGTCGGCCTGATCTCTTTATTACTTTTACCTGTAATCCAAAATGGATAGAAATTACTCAATTGCTGCTTACCGGACAAACATCAAGTGATAGACACGACATCACAGCACGTATATTCAGGCAAAAAATTCGGTCCCTGATGAACTTTATTGTTAAACAACGCGTCTTTGGAGATACTCGATGCTGGATTTATTCAATCGAATGGCAAAAGCGAGGCCTGCCGCACGCACACATTCTTATTTGGTTAGTGGAAAGAATTCAGCCTGACCAAATAGATGATATCATATGTGCTGAGATTCCTGATTATGAAGTCGATCCAGACCTACATGATGTTGTTACTACTAATATGATTCATGGACCGTGTGGTGCCATCAATCCCCAATCACCTTGCATGGTCGATGGAAAGTGCTCTAAACGATATCCACGGAAATTAACGGCGGAGACTGTCATTGGCATTGATGGTTATCCGCTGTATCGGTTAGGAATGCCAGCACCACATCGTGAAATGAATGACGCATTTAATCGAGAATTGGAAAGGGAACGTGAATATGATCACCAGGAATTAGATTTAGTAGTTCAAACGATGGTACCCCTGTTGAATTACCAACAAAAGGAAGTTTATGATACTTTAATGAAGGCAATCGATGATGAAAATGGTGGTTTATATTTCCTAGATGCCCCTGGTGGAACTGGCAAGACATTCCTCATGTCATTAGTTTTAGCAACTGTTCGGGCGAGATTTAACATAGCGGTTGCAGTTGCTTCTTCTGGAATAGCAGCCACATTGTTAGAAGGATGCCGTACGGCTCATTCAGCATTCAAATTACCGTTAAATCTTCAAACTATTGAAGAACCAACGTGTAATATTGCAAAACACTCAGCAATGGCCAAAGTTTTAGCGGTATCGAAAATCATCATCTGGGACGAATGCACAATGGCGCATAAACGTGCATTAGAAGCACTTAACCGAACATTAAAAGATTTACGCAATGACTCGAGATGTTTTGGAGGAGCAATGATTTTACTTTCTGGCGATTTCCGCCAAATACTGCCAGTAATTCCAAGATCTACGGCTGCCGACGAAATAAACGCTTGCCTCAAATCGTCAAATCTATGGCGCCATGTGAAGAAACTGCAACTGACAAAAAACATGAGAGTTACATTGCTTAATGATACATCTGCTGCTGATAAATATGCATCTGCTGAAGATTTCTCGGAGCAATTGCTGACTATCGGTACTTAA
Protein
MGNMEEQLDRRLEINAGMKRAILQDLQCLLHEHHALVRLFKSALERMPSDDYKVVIKADKRPSGTHERTFNAPTVDEVAILIVGEKLEKRDIVLTRRDTGQLQQISETHRSYDTLQYPLMFWQGEDGYYFNIKMKNPLNGEETTKKVSSMNYYAYRLMIRQNADNYLLRFRRLFQQYCVDMYVKIETERLTFIRLNQAKLRSEEYIHLRDAVSTEGNAANIGRLTILPATYIGSPRHMHEYAQDAMTYVRHYGRPDLFITFTCNPKWIEITQLLLTGQTSSDRHDITARIFRQKIRSLMNFIVKQRVFGDTRCWIYSIEWQKRGLPHAHILIWLVERIQPDQIDDIICAEIPDYEVDPDLHDVVTTNMIHGPCGAINPQSPCMVDGKCSKRYPRKLTAETVIGIDGYPLYRLGMPAPHREMNDAFNRELEREREYDHQELDLVVQTMVPLLNYQQKEVYDTLMKAIDDENGGLYFLDAPGGTGKTFLMSLVLATVRARFNIAVAVASSGIAATLLEGCRTAHSAFKLPLNLQTIEEPTCNIAKHSAMAKVLAVSKIIIWDECTMAHKRALEALNRTLKDLRNDSRCFGGAMILLSGDFRQILPVIPRSTAADEINACLKSSNLWRHVKKLQLTKNMRVTLLNDTSAADKYASAEDFSEQLLTIGT

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
Pfam
PF14214   Helitron_like_N        + More
PF05970   PIF1
Interpro
IPR027417   P-loop_NTPase        + More
IPR025476   Helitron_helicase-like       
IPR010285   DNA_helicase_pif1-like       
SUPFAM
SSF52540   SSF52540       
PDB
5FTE     E-value=0.0285226,     Score=90

Ontologies

Topology

Length:
665
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.24605
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00064
outside
1  -  665
 
 

Population Genetic Test Statistics

Pi
272.555001
Theta
27.131761
Tajima's D
2.490442
CLR
0.379694
CSRT
0.944702764861757
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号