SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12819
Annotation
unnamed_protein_product_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.741
 

Sequence

CDS
ATGGAGTTATCTGCTGCAAGTCTCTTAACACAGCTTATGATACGTGTCTCGACTCAATTGTTGTCCCATATTACCATAAAGCAACACATATGCTGGTCAGACAGTACCATTGTCCTAGCATGGCTAAACACACCTCCTCATAGACTTCAGGTCTTTGAAGCTAACAGGGTTGCCAAGATAACATCCAATCCAATCACCTCCACATGGAAACATGTTCCTACAAACCTGAACCCTGCAGACTGTGCGAGCAGGGGAATGTCTGCCCAGTCACTATCGGCTCATGATCTTTGGTGGTCTCCTGGCTGGCTGAAGGAGCCTCCTGACACCTGGCCCAAAATGCCTCCTGCTCTAGGCCACCATGCATTACCAGGTCTGAAGCCCAAGAAAGTACCAGCTCATGTGGCGGTTCCTGACCTCGACCTTGACTTGCTTACTCGATTCAGTTCTCTCGACAAGCTCGTTGGAGTGACAGCTTGCATAAAACGCTTTATTTTCAATTGTAGACACAACTCAACTGATAGGCGCTCTGGTCCCTTGACAGTTGGAGAACGTACAGATGCTCTGTTATTCTGGGTTCGCTCTGTTCAACACAATGAGTTTGCGGAAGATATTTACCGTCTTCAGGCAGGCAAGATTTGTACCGTTCGACTTCAGCGTCTTTCACCCTTGATGAAAGATGATCTCTTGAGAGTTGGTGGTCGCCTCACTCATGCGCCAATAAGATACGATGCTCAGCATCCTCTCGTTCTGCCCAGCTCTAGCCCACTAGTTGATCTCATCATAGACCACTATCACAGAATAAACTGTCATCCTGGGGCTGACACATTACACGCTATCCTCCGTCAGCAGTTCTGGATACTCTCAGCACGTCGTGTCATCAGGCATCGCCTCATCCAAGCTCTCTCTCAGCGTTTTTGGACTCTGTGGACCAAATCCTATCTCCATACCCTCCAAACCCGCTCCAAATGGCTTTCCACATCCTCACCTCCTCAAGTTGGAGAGCTCGTCCTCATCAAAGAGGACAATCAGCCCCCGCTGCAATGGAAACTTGGAAGGATTATCCGCACGTTACCCGGCAAGGATGGAGTGATCAGAGTCGTGGATTTGGACACGAAGCATGGAAGTCTGCGGAGACCTGTGTTCAAGTTAGCCAGGTTGCCGCTGGATTCAGCACATGAAGAAGTTCAGCCCCGGCCGCCCCAGGATAACCCATAA
Protein
MELSAASLLTQLMIRVSTQLLSHITIKQHICWSDSTIVLAWLNTPPHRLQVFEANRVAKITSNPITSTWKHVPTNLNPADCASRGMSAQSLSAHDLWWSPGWLKEPPDTWPKMPPALGHHALPGLKPKKVPAHVAVPDLDLDLLTRFSSLDKLVGVTACIKRFIFNCRHNSTDRRSGPLTVGERTDALLFWVRSVQHNEFAEDIYRLQAGKICTVRLQRLSPLMKDDLLRVGGRLTHAPIRYDAQHPLVLPSSSPLVDLIIDHYHRINCHPGADTLHAILRQQFWILSARRVIRHRLIQALSQRFWTLWTKSYLHTLQTRSKWLSTSSPPQVGELVLIKEDNQPPLQWKLGRIIRTLPGKDGVIRVVDLDTKHGSLRRPVFKLARLPLDSAHEEVQPRPPQDNP

Summary

EMBL
AB012906    BAA33576.1    AB012907    BAA33577.1    GEBQ01018232    JAT21745.1    + More
GEBQ01015599    JAT24378.1    GECU01010337    JAS97369.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GBHO01004194    JAG39410.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GECZ01006169    JAS63600.1    GEBQ01005223    JAT34754.1    GGMR01000737    MBY13356.1    GBHO01004196    JAG39408.1    ABLF02052963    GALX01004947    JAB63519.1    ABLF02008594    ABLF02006304    ABLF02036268    AJVK01036816    GBHO01021103    GBHO01021101    JAG22501.1    JAG22503.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    FR933523    CDQ97861.1    GDHC01006469    JAQ12160.1    GDHC01016272    JAQ02357.1    GFTR01008874    JAW07552.1    ABLF02041863    ABLF02035110    ABLF02067347    ABLF02025958    ABLF02030854    JYDW01000019    KRZ61310.1    GBHO01003578    JAG40026.1    GGMR01002421    MBY15040.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    ABLF02017373    GDHC01011948    JAQ06681.1    GDHC01018560    JAQ00069.1    GALX01005107    JAB63359.1    GBHO01023090    JAG20514.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GEBQ01029803    JAT10174.1    GGMR01017890    MBY30509.1    GBHO01044316    JAF99287.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GEZM01054765    JAV73413.1    GGMR01015135    MBY27754.1    MCIT02012214    PHT96336.1    LBMM01009551    KMQ88039.1    GBHO01038469    JAG05135.1    GGMR01013370    MBY25989.1    GBHO01033788    JAG09816.1    GGMS01016125    MBY85328.1    GDHC01006567    JAQ12062.1    MCIT02006707    PHT96417.1    ABLF02028666    ABLF02066713    GBRD01004944    GBRD01004943    GBRD01004942    JAG60878.1    LBMM01009964    KMQ87756.1    LBMM01012392    KMQ86241.1    GBHO01019080    JAG24524.1    GBRD01007977    JAG57844.1    GDHC01014337    JAQ04292.1    GBHO01006408    JAG37196.1    GBHO01019177    GBHO01003185    JAG24427.1    JAG40419.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    ABLF02017056    GEZM01072348    JAV65549.1    LNIX01000063    OXA37199.1    GDHC01014057    JAQ04572.1    GBHO01010487    GBHO01010485    JAG33117.1    JAG33119.1    ABLF02036131    ABLF02041527    ABLF02064049    GBHO01010489    GBHO01010484    JAG33115.1    JAG33120.1    LBMM01012238    KMQ86334.1    JTDY01005490    KOB66948.1    GAMC01003146    JAC03410.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    JYDK01000001    KRX85640.1    ABLF02005684    GBHO01027267    JAG16337.1    QOIP01000002    RLU25473.1    LNIX01000002    OXA60848.1   
Pfam
PF05380   Peptidase_A17        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF00665   rve
PF03564   DUF1759
PF05585   DUF1758
PF00078   RVT_1
Interpro
IPR041588   Integrase_H2C2        + More
IPR008042   Retrotrans_Pao       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR000477   RT_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
404
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01275
Exp number, first 60 AAs:
0.01154
Total prob of N-in:
0.00203
outside
1  -  404
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
254.46771
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号