SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12810  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA012740
Annotation
PREDICTED:_peroxidase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.702
 

Sequence

CDS
ATGCTCTGGTCATTAGTTTTCTTGGCGTTTCTGAAGCTGACCGCCGGTGTTCGCTATGAATCGTTTTCTGGTCTACCAGCGACTGATGAAAAGATCCAATACTTCATCAAACAGGAAAATTTAGATAACTGCACCAATGACATTCAACTCCCCTGCGACCCCAATGAGAGACGACGTCTAGATGGCTCATGCAGTAATTTCGACTATCCGTCAAGAGGAACATTCCATACCCCTGTGATAAGATTGTTACCCGAAGCCGACTGTGGAGACGATGAAACCTCTCCATCTGGAGCTCCTTTAAAATCTGCCCGGGAAGTCAGGCAGCGTATTTTACAGACAGGGAAGGCATCAGACCTCTCATACACACAACTATTGGCGATTATCTCGACAATCATATTTGCTGACCTTGGTTCAATCCATGATTCCGTGAATTTGTTAACGGAGACCACAAATTGTTGCACAGCGGAAGGAAAATCAAATTATATGTGCACGCCTATAGATATTCCCCAGGACGACCCTGTCCATAGGTTCTCTGGTATACGCTGCTTGAATCTCACTCGACCGAAATCGTTCCAGACTTATGGCTGCCTTGCTGACTCGAATGTAGACAGAATCGAATTCACAACACCGTTATTTGATTTATCGACTATCTACCGATCGACCGAACCGGCTCCAGAATACAGAACATACAGTGGCGGATTACTGATGACCCAAGAGGCCGATGGCACCATCTTCCCCCCACAAGAAGGACCGCACAGCAATAAATGCTTGCAAAACGACGCGTCTAATGGAGAAACGAAATGTTTTGGCCCTGTTTCAACATCGATTCTGCCGGTCACATTGTTGGTCGTGTGGTGGTGGAGACTACACAATAAGATCGCCAAAGAACTAAACGAAATCAATCCTCATTGGGATGACGAAACATTGTTCCAAACTGCAAGGGACATTAACATCGCAATAACAAACCAATTTGTTTACTACGAATTGCTGCCAACTCTATTCGGTGAAGAATTCTGTTTGAAAAATGAGCTGATTCACTCTGAATCTGGACACAGAGACCTTTACGATGAGTCTATACCTGCTACTTATCTCGAATACTACCTCGCTTTGAGATGGTTCCACTTGGTTTCAGAGGGTGATTTGAAACTTTTCGACGAGGATTTCAAGTACGTGGGCAAAAAAATGGTAACAGACCTCTCTTTACATACTGATTTCTTGATGAGAGATAAGAACTTGGCAAAAATGACACGAGGAACTTACTATCAGGCTGGAGGAGATAATGATAGAGCTGTAGACCCGGCCATTTGTGATAAGGGATTAGGAATAATGCAAAAAGCATCCGACCTTACAGCAGCGGATTTGAGGAAAAATCAGCTTTTCAAAATTCCACCTTACGTCGACTACGTAAAACTGTGCCATGATGTCGAAATTAAAACATGGAAAGACATGTTGAAATTCATTGACATGGATCGAATTGAAAGTCTGCAAGAAATTTACGAAACCCCTGGTGACGTGGAACTCCTGGCAGGAATCTGGATTGAAAGACCTATGGAGGGAGGTTACGTTCCTCCAACCGCAGCTTGTATCATAAACAAACAACTGTCTCTCACTATGAAAGCTGACAGACATTGGTATGAGAGATCGGACAGACCCTACGCTTTCAATGTCGCTCAGCTGGCGGAAATAAGAAAAGCAACAGTTGCAGGCTTCCTTTGCGAAGTTGGTGACGGTGTAGAGAGAATCCAACGGGAGGCACTTAAAAGAGTGACTGCTTCGAATCCATTGGTCAGCTGCCAAGAAATCCCGAGATGGAATCTCGCTGCTTGGAAAGAATCTAAGTGA
Protein
MLWSLVFLAFLKLTAGVRYESFSGLPATDEKIQYFIKQENLDNCTNDIQLPCDPNERRRLDGSCSNFDYPSRGTFHTPVIRLLPEADCGDDETSPSGAPLKSAREVRQRILQTGKASDLSYTQLLAIISTIIFADLGSIHDSVNLLTETTNCCTAEGKSNYMCTPIDIPQDDPVHRFSGIRCLNLTRPKSFQTYGCLADSNVDRIEFTTPLFDLSTIYRSTEPAPEYRTYSGGLLMTQEADGTIFPPQEGPHSNKCLQNDASNGETKCFGPVSTSILPVTLLVVWWWRLHNKIAKELNEINPHWDDETLFQTARDINIAITNQFVYYELLPTLFGEEFCLKNELIHSESGHRDLYDESIPATYLEYYLALRWFHLVSEGDLKLFDEDFKYVGKKMVTDLSLHTDFLMRDKNLAKMTRGTYYQAGGDNDRAVDPAICDKGLGIMQKASDLTAADLRKNQLFKIPPYVDYVKLCHDVEIKTWKDMLKFIDMDRIESLQEIYETPGDVELLAGIWIERPMEGGYVPPTAACIINKQLSLTMKADRHWYERSDRPYAFNVAQLAEIRKATVAGFLCEVGDGVERIQREALKRVTASNPLVSCQEIPRWNLAAWKESK

Summary

EMBL
BABH01034746    BABH01034747    KQ459324    KPJ01647.1    KPJ01645.1    KPJ01646.1    + More
AK401278    BAM17900.1    KZ149907    PZC78258.1    NWSH01002854    PCG67434.1    AGBW02012596    OWR44740.1    ODYU01007226    SOQ49823.1    ODYU01007479    SOQ50286.1    KQ460416    KPJ14923.1    NWSH01006580    PCG63355.1    RSAL01000046    RVE50539.1    PZC78257.1    KPJ14922.1    ODYU01004596    SOQ44641.1    BABH01034743    BABH01034744    PZC78259.1    NWSH01001320    PCG71707.1    KJ995811    AIN39494.1    ODYU01007325    SOQ50002.1    ODYU01007063    SOQ49501.1    BABH01028746    BABH01028747    BABH01028748    RSAL01000273    RVE43156.1    KZ149956    PZC76461.1    PZC76464.1    NWSH01001116    PCG72533.1    NWSH01006414    PCG63451.1    PZC76463.1    NWSH01006200    PCG63597.1    BABH01013455    KQ459564    KPI99614.1    PCG72532.1    RSAL01001640    RVE40744.1    RSAL01000844    RVE41114.1    KQ459837    KPJ19761.1    RSAL01000231    RVE43837.1    BABH01013458    BABH01013459    BABH01013460    RSAL01000083    RVE48485.1    RVE41111.1    NNAY01001189    OXU24803.1    KZ288187    PBC34719.1    ADMH02000540    ETN66033.1    KJ995807    AIN39490.1    GGFK01004863    MBW38184.1    GGFK01004599    MBW37920.1    DS231994    EDS30856.1    DS232811    EDS45917.1    GL447257    EFN86678.1    GAMC01010556    JAB95999.1    MH606240    AXM43807.1    CH477371    EAT42428.1    NEVH01006567    PNF37876.1    GGFL01015608    MBW79786.1    CH478998    EAT32533.1    KQ760645    OAD59676.1    QOIP01000004    RLU23752.1    JXUM01046680    KQ561486    KXJ78429.1    AF098717    AAC97504.1    KQ971317    EEZ99172.1    RSAL01000011    RVE53586.1    KQ414666    KOC65001.1    CVRI01000064    CRL05204.1    AAAB01008848    APCN01003535    EAA07042.4    KK852427    KDR24107.1    KK107453    EZA50655.1    AXCN02001762    RSAL01000094    RVE47835.1    GBXI01013522    JAD00770.1    UFQT01001180    SSX29359.1    ATLV01000829    KE523910    KFB34769.1    GEBQ01006041    JAT33936.1    GGFM01006040    MBW26791.1    GAKP01002541    JAC56411.1    GAKP01002543    GAKP01002542    JAC56410.1    JN003585    AEJ88361.1   
Pfam
PF03098   An_peroxidase        + More
PF00083   Sugar_tr
PF00075   RNase_H
PF01404   Ephrin_lbd
PF14575   EphA2_TM
PF00041   fn3
PF07647   SAM_2
Interpro
IPR010255   Haem_peroxidase_sf        + More
IPR029585   Pxd-like       
IPR019791   Haem_peroxidase_animal       
IPR037120   Haem_peroxidase_sf_animal       
IPR005828   MFS_sugar_transport-like       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
IPR011641   Tyr-kin_ephrin_A/B_rcpt-like       
IPR008979   Galactose-bd-like_sf       
IPR001426   Tyr_kinase_rcpt_V_CS       
IPR003961   FN3_dom       
IPR027936   Eph_TM       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR013783   Ig-like_fold       
IPR013761   SAM/pointed_sf       
IPR001090   Ephrin_rcpt_lig-bd_dom       
IPR036116   FN3_sf       
IPR001660   SAM       
SUPFAM
SSF48113   SSF48113        + More
SSF103473   SSF103473       
SSF53098   SSF53098       
SSF49785   SSF49785       
SSF47769   SSF47769       
SSF49265   SSF49265       
SSF57184   SSF57184       
PDB
3R5Q     E-value=1.4427e-28,     Score=316

Ontologies

Topology

SignalP
Position:   1 - 16,         Likelihood:  0.982412
 
 
Length:
613
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17189
Exp number, first 60 AAs:
0.03971
Total prob of N-in:
0.00380
outside
1  -  613
 
 

Population Genetic Test Statistics

Pi
171.660697
Theta
126.845512
Tajima's D
0.945588
CLR
1.20935
CSRT
0.64046797660117
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27102218 IFDEDFKYVGK 96.43 8e-15
27102218 TWKDMIK 100.00 1e-09
24093152 SNVPHDPVR 100.00 2e-07
27102218 IPPYVDYVK 100.00 2e-07
28467696 SNVSSTIPSGQISNVPWR 100.00 2e-07
24093152 PMDSDAEWIP 100.00 8e-07
27102218 GTYYQAGGDNDRAVDPAICDK 100.00 8e-07
24093152 GTYYCVADNGVGK 100.00 0.007
27102218 AVDPAICDK 100.00 0.007
28467696 GTWSDAGMSTFISHQVTR 100.00 0.007
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号