SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12803
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.487
 

Sequence

CDS
ATGACAAAGCCGCGCACACGTCGTCAGTCTCGTCGACAATCCGAGTATTTCGAACCGACAGAGGACGATTCTTCCCCGCCGCCGACTGCATCGGGAAACATTTCCGTCAACGACATGGTTGCCATGATGTCTACGTGGCAACGCAACCAAGAGGAAACGTTTGAGAAACTTCTACATACAGTTCTCAACCAATCGCACCGGTCATCGCCGCCGCCCGCTCAACCTGCACTTGGAAACTTCGCCTCGTGCAAGGCTCGCTACAGCGGAGCGCCAGACGAATCACTTGACGGATTTATAGACGCCGTAGAGGCCTACAAGGAATGTGCAAACGTAAGCGAAACTAATGCACTACGTGGGTTGTCAATGTTGTTAACTCATGAAGCCGCGACATGGTGGCAAGGAGTTAAGACCACCATGAACAAGTGGGACCACGCCCTCACATCCCTAAGAGGTGCGTTTGGTGATAGCCGACCTCCACATCGTATATACAAGGAGCTGTTCGCCAACCCACAAAAAGCAAGTGAGAAAACAGAACTCTTCATCTCTAAAACTCGAGCGCTACTATCACGTCTGCCAAAGGACGATCTGACAACCAAAGTACAGATGGACATGGTGTATGGACTACTACATAGTAAAATACGCGAGCGTTTGAGAAGAGAGGAGATTGACACATTTGACACGCTACTCAGAAAGTCTAGAGAGATAGAAGAATCTTGTGACGAGAGTCTATCAACTAGTGGCCTTCAGAGCAAACTGCGCCAACGCCAGTTTCCACCGCCTCGTCACGCCGCAAGCATCGCCGCTGTCCAGGGGTCAACGACCGCGCCACCACTACCACCGCAGAGCGCGCCTAAGCCGCCTGCGCCCGCCGTTGAGTCCAGCGCCCACGGCACCTATCGCCGTTCTCTTCGCTGCTCCGTGGTGCCGCCCCCACCGTCGTCTCCACAACCCCACGGCTCTTCTACTCAGTTCGTGAACGCCAGACGTCGATATTGTTTCTATTGCAAGAACTATGGACATACACGTGAAGAGTGTCGTAGGTTAGCAGCTAAAGGCAGACAGGACATCGATAACGCCGCCGACCCCGTCCCGTCGTGTTACGGATGCAACGAGAAAGGTGTCACTCGATCACAGTGTGCTAAATGCAATTCGGACTTCTCTGCGTGTGAATACGACGGTCCGAAAGGCGCGCTGATGGGAATTTACGGTACAAGAACGACCACATGTTCGAACATTTCTCTGTCGACTCTTGACTCAACTAATTTAGACGCTCATCCACAAGTGCCAGACACTTGTCAATCACAACGGAGACCGATTCTAGGAGTGGAAATTCTAGGAGTAAGGGGTACCGCACTATTGGATACAGGTGCTAAAGGGTGTATTGCGGGTGCTTCCTTATATCAGGTGTTGCTTAAACATAATCATCCCTGCCAAGAAACCACTAAACGCGTTCGTCTCGCTGATGGCTCCGTGCAGATTCGTGAGTTGTTGGTTACTAACCTGCATGTGAAAATGAAAAATAAACTGCTATGTTTGGAGTTCATTATTTTTCCAGAGACCAAATCCAATGATACTATTCTTGGTATGGATTTTATTGCCTCAGCGGGTATGGTGATTGATTTCGCTGCTTCAATTTGGTATTTCTCTGGGGATGAGGTGACTTACCCATTGGAATTTGAACTTTCCAGACCATGCGTGTCCGTATCCTCTGCAGATTTCCTACGTGAAGAGGAAGGAGTTATGCTGCATCCTAAGGAGAGACTGCTGTTGTCCGACTTTCTGAAACAGAACGAAGACCTGTTCGAACCAGGGGGAGGGCCGACTCCGTACGCAGAGCATCACATCGACACCGGCGATAACGCTCCTATTGCCGTTCCACCGTATAGGCTCACTCCAGCAAAAAGAGAGGTGATGAAGGCAGAGTTGGAGAAAATGTTAGCTGACGACGTGATCGAAGAGTGTGAGTCTGCGTGGTCTGCGCCTGCTCTTCTTGTCCCGAAGAAGGACGGATCTTTCAGATTTTGCGTCGACTACCGTCGTCTTAATGCGATTACTAAGACCGACAGTTATCCAATTCCCTTAATCGATGATTTATTGCAGATGACTAGACGGGACTGTCACATGTCCACCATTGACCTGCGCGCCGGATATTGGCAGGTCAATGTAGCTGAAAAAGACAGAGACAAAACCGCTTTTATAAGTCCTTTTGGTACGTATAGGTTCAAGCGCATGCCGTTCGGCTTAAAGAACGCACCGTCTACCTTCCAGCGACTCATCGATCGTTTCCGCTCAAGCTCGTCGCTGCAGGACATCTTTCTGCTGGCTTATTTGGACGACCTCTTATTGATTACACAGGGAAGCTTTCAAGACCACCTTCAGGACCTCGACAAGGTGTTTGACAGACTGCGTCACTTTGGACTCCACGCGAACCGCGCCAAATGTCACTTTGCTCGCCAAGAGGTAACATACTTAGGCCATGTGATCACACCCAAAGGAATCAAGCCGGATAGCACCAAAGTCGACGCCGTCCTGAAAATGAAGGAACCGCACAATCTCAAACATTTGAAATCATTTTTACAGACCTGTTCCTGGTTTAGGAAATTCATTCCTGACTTCTCGCGTATTGCTGAACCTCTGACGAAACTTACCCGCAAAAACGAAGCGTGGACCTGGGGTGAAGCACAACAACGCGCCTTCGACCTGCTAAAGAGTAAGCTTACTAGCGCTCCTATTTTGATACAGGCCGACTACACTCAGCCCTTCTTGCTGCGCACCGACGCCAGCAATTATGCTATAGGGGCTGCACTGTTACAAGGTAACAATAACAATGAAAAACCAATCGAATACGCCAGCAGACTTCTGACGTCAGCCGAGAGGAATTACTCTACCACCGAGCGGGAAGCGCTCGCAGTCGTCTGGGCAGTGGAAAAGTTCAGGGGATACATTGATGGCCATCTATGCATAGTCAAAAGTGACCACCAGCCACTTAAGTGGTTGCTTACACTCAAGTCCCCAAGTGGTCGTCTCATCCGATGGGCACTAAAACTCCAGGCGTTTGATCTCAAGATAGAATACTCTCCAGGTAAAGTTAATACCTTGGCTGATACTTTGAGTCGACCTACCTGTGACGGTACCAACGATTGCGAAGTGTGCTCCGTGACCGTCGACTACCCTCAAGCACTGCCGAGCCAGCTACGAGCCGAGCAGCTTGAAGATCCAGAAGTGGCTAAAATTATACAAGACCTAGAAAGCGTAGACGAACTTACCTCTACTCGGTGGCTGGAACGTGGATATGTACTGCAGCAGGGCGTGCTATACCGTTATGATCCAGATAACGACTCTGAAGAAGCGCAGATGGTAGTGCCAATTTCAAAAAGGAAAGAAATTTTAAAGTCGTTTCACGATTCGCCAACTGCAGGCCACCAGGGTATTGAGCGGACTCTACAACGCATCCGTGAGCACTTCTTTTTTCCCGGAATGCGTCGTTACGTCACAGAGTACCTAAAGAACTGTGTGGACTGTCTCAGGTATAAAGCCGCAAACCAGAAACCAGCTGGTCTCCTCCAGACACCCGTCCTCCAACAAAGATCTGAAGTCCTGGCGATGGATCTTTTCGGCCCCCTGCCTGAAGGAGATCAAGGACAACGTTGGGTCCTTATTGTTGAAGACGTAGCTACCAGGTGGGTGGAGCTGTTCTCGCTTGTGGAGGCCACAGCAGAAAATTGCGCCAAGCTTCTTATAGAGGAATACTTCCTCAGATATGGATTGCCACGCCGAGTTGTGTCCGACAACGGGACTCAATTCATATCCTCAGTGATGCAACTTTCAATGTTTATTTTAGGTATTAAACAAGAGCTCATCCCAGTTTACCACCCTGAGGCTAATCCCGTCGAGCGCAAGAATCGGGATCTCAAAGTACAACTGTCTTTATTAGTAAAAACCGAGCACCGGAACTGGCCTAAATATCTTGCCCATGTTCGGTTCGCTATGAACAGCGCCGTCTGTTCCACCACTGGGAAGACTCCAGCCTTTTTAACGTTCGCACGCGAGCTTCGCACACCTTATGAGATGCACCATGATTTACGTGCAATATTAGATAAAGAGAACTTCGTTCCTTCGGCCACTCCATATTTGCGCTCCTTCATACGTACCCTACAGGATATTCGTGATCGTGTTGAGAAGAAGCAAGATCAGCGTAAGGAGATAGGTGATACTGCACGCCGTCCTATGCCTCCTTATAAAGAAAATGATTTGGTCTTGGTCAAAACCCACGCACTGAGCAATGCCTCGAAAGGAACTACCAGCAAATTCATGCCAAAACGAGATGGCCCATATCGCGTTAAACGTGTTATAACTCCCACTACCTTTATACTCGCTAATTTGACTGACGACGACACTGTCATAGGAAAATACCACAGTTCGGACTTGACCCCCTTTACTCAAACGTCTGATACCACACCCATTGTTCCAAAGAAAGGTAGGGGTAGGCCGCGTATTAAACCGTCAGATACCAAGTTGGACCCGGGACGTGCTACCAACTTGGAGGGGGAGCCTATAACGCGACGGGACATTTCCGAACGCACCCTTAATTCCCATCAGCGCGTTCCTCGGAACGCGCCTCAACCGGCCGTGATTGGTCCGCGACCGCGCCGCCATCGCAAGCCGCCACTGCGCTTGCGCATGATGGACTGA
Protein
MTKPRTRRQSRRQSEYFEPTEDDSSPPPTASGNISVNDMVAMMSTWQRNQEETFEKLLHTVLNQSHRSSPPPAQPALGNFASCKARYSGAPDESLDGFIDAVEAYKECANVSETNALRGLSMLLTHEAATWWQGVKTTMNKWDHALTSLRGAFGDSRPPHRIYKELFANPQKASEKTELFISKTRALLSRLPKDDLTTKVQMDMVYGLLHSKIRERLRREEIDTFDTLLRKSREIEESCDESLSTSGLQSKLRQRQFPPPRHAASIAAVQGSTTAPPLPPQSAPKPPAPAVESSAHGTYRRSLRCSVVPPPPSSPQPHGSSTQFVNARRRYCFYCKNYGHTREECRRLAAKGRQDIDNAADPVPSCYGCNEKGVTRSQCAKCNSDFSACEYDGPKGALMGIYGTRTTTCSNISLSTLDSTNLDAHPQVPDTCQSQRRPILGVEILGVRGTALLDTGAKGCIAGASLYQVLLKHNHPCQETTKRVRLADGSVQIRELLVTNLHVKMKNKLLCLEFIIFPETKSNDTILGMDFIASAGMVIDFAASIWYFSGDEVTYPLEFELSRPCVSVSSADFLREEEGVMLHPKERLLLSDFLKQNEDLFEPGGGPTPYAEHHIDTGDNAPIAVPPYRLTPAKREVMKAELEKMLADDVIEECESAWSAPALLVPKKDGSFRFCVDYRRLNAITKTDSYPIPLIDDLLQMTRRDCHMSTIDLRAGYWQVNVAEKDRDKTAFISPFGTYRFKRMPFGLKNAPSTFQRLIDRFRSSSSLQDIFLLAYLDDLLLITQGSFQDHLQDLDKVFDRLRHFGLHANRAKCHFARQEVTYLGHVITPKGIKPDSTKVDAVLKMKEPHNLKHLKSFLQTCSWFRKFIPDFSRIAEPLTKLTRKNEAWTWGEAQQRAFDLLKSKLTSAPILIQADYTQPFLLRTDASNYAIGAALLQGNNNNEKPIEYASRLLTSAERNYSTTEREALAVVWAVEKFRGYIDGHLCIVKSDHQPLKWLLTLKSPSGRLIRWALKLQAFDLKIEYSPGKVNTLADTLSRPTCDGTNDCEVCSVTVDYPQALPSQLRAEQLEDPEVAKIIQDLESVDELTSTRWLERGYVLQQGVLYRYDPDNDSEEAQMVVPISKRKEILKSFHDSPTAGHQGIERTLQRIREHFFFPGMRRYVTEYLKNCVDCLRYKAANQKPAGLLQTPVLQQRSEVLAMDLFGPLPEGDQGQRWVLIVEDVATRWVELFSLVEATAENCAKLLIEEYFLRYGLPRRVVSDNGTQFISSVMQLSMFILGIKQELIPVYHPEANPVERKNRDLKVQLSLLVKTEHRNWPKYLAHVRFAMNSAVCSTTGKTPAFLTFARELRTPYEMHHDLRAILDKENFVPSATPYLRSFIRTLQDIRDRVEKKQDQRKEIGDTARRPMPPYKENDLVLVKTHALSNASKGTTSKFMPKRDGPYRVKRVITPTTFILANLTDDDTVIGKYHSSDLTPFTQTSDTTPIVPKKGRGRPRIKPSDTKLDPGRATNLEGEPITRRDISERTLNSHQRVPRNAPQPAVIGPRPRRHRKPPLRLRMMD

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF03732   Retrotrans_gag
PF00665   rve
PF00078   RVT_1
PF17917   RT_RNaseH
Interpro
IPR000477   RT_dom        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR005162   Retrotrans_gag_dom       
IPR012337   RNaseH-like_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR003034   SAP_dom       
IPR041373   RT_RNaseH       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=3.4507e-68,     Score=662

Ontologies

Topology

Length:
1563
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10785
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.00473
outside
1  -  1563
 
 

Population Genetic Test Statistics

Pi
1.845747
Theta
10.733545
Tajima's D
-1.439318
CLR
27.586213
CSRT
0.0660466976651167
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号