SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12801
Pre Gene Modal
BGIBMGA010456
Annotation
hypothetical_protein_RR48_13816_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.367
 

Sequence

CDS
ATGGATATTAAATCATTAAAGAAAACTAGATCTAGCCATAAGGCGAAGCTTACCATATTTAAAACATATATAGATTCACTTTTGCCTAGTAAAAGGGTCAATGAGGTACAAGCTTTTGAATTAAAGGCTCGCTTAGATAAAATTCTAGATTTATACAATGAGTTCGATTCAGTTCAGACTGATTTAGAAAGTCTTGTGGAAATTTCAGATGATGAACACAAGGAAAGAGAGATTTTCGAGAACAGCTACTTCGGCTGCGTGGCTTTTGCGCAGAAGATGCTCAGCGCTGCCTCTGCGGATCAGGATGCCGGGTCGGTGACGGGTTCTAATATTAACACTGGACCGTCTGGTAGGCCAAACATTAAATTACCTACTATAAATTTGCCGATCTTTTCTGGACGCTATCAGGAATGGCTAGAATATCACGACACTTACAAATCCCTTATACACGACAACACAACCATTCCCAAAATCCATAAGTTTCACTACTTACGAAATACATTAAAAGAGAGCGCTTCATATATTATTAAATCCCTAGAGTTCTCCGCTGAAAATTATGACATCGCATGGGATCTGTTATGCGATCGATATAATAACGATCGAATTTTGGTCAATAATCACATACAAGCAATATTTAACATACCAACAATAGTTCAAGAATCGTCCAAGGCTTTAAGAAGTACAATAGATTCAGTTAATCGAAATTTAAGAGCTTTAAAAACACTGAATCTACCTACAGAGCACTGGGACATTATCATAATACACATGGTGTCTGGTAAGTTAGACCCAGGCACACTACGTGACTGGGAAGAGAAACGCAATAATTTAACGAGATTACCTACGTTACAAGATTTTCACACATTTCTAAAAAATCGTGCTGACTTACTAGAGACAGTGGAAGAATCATCAACATATACAAAACAGCAACCATCACAACGCAGACACAGCGATATTACTCACAACCGTCCAAAGACGTTTGTAGTTAACCAAACACAAAAACAAGCGCTGTTTAGATGTCCTGTGTGCAAGAATAATCATGCAATTTACCAATGTATGAAATTCAAATCAATGCCGATTGAGATGCGTCTTGACCGAGTTAAACAATTAAATCTATGCACAAACTGTTTGCGTGCAGGTCATGATGAACAGCGCTGTAGGCTCAGTTCCTGTAAGCTGTGCACACAGCGCCACAACACTCTGTTACACAATAAAAACACTGTTCCGGAAGCTTCAACTTCATCAGCGGGCTGTGTAGTCTTGCCCACTGTGCAGGAACAGACTCAAAAGGAATCGAGTGGTGTCACACTCTCATCCACACATCACAGTCAGGTACTTCTATCCACTGCTATGGTCAATATACAAGGCTGTGATGGTCAAACACATAAAGTTCGTGTACTACTCGACAATGGAAGTACATCTAGTTTTGTCACAGAAACTTTACGAGCGAAATTAGGAATACGCAGTTATTCTACTTCACTACTAGTACAAGGGTTGAACAATCAGTCCTCAAAAATTACAAAAAGATGTGACGTCACCATATCGTCACTCACAAGCAGTGGTTATACAACTGACGTCAATTGTTTTGTTGTACCACATATCACTCAGTTGATACCTACTTCACAAATTAATTGCAATTTCTTTTTCATTCCCTCTCGCATCCACCTCGCGGATCCAACCTTCTCCACGCCGTCTGAGGTGCAGATGTTGCTGGGGGCGGACATCTTTTGGGATGTCCTTCAAAACAATCATATTGTCCTGGGAAAGAACAAGCCAACTCTGATTGAAACAACATTAGGGTGGCTTGTCACCGGCTCTATACGATCAAACACAAAATTTAACACCAACAATACAGTCCATTGCCATTTTCTAAACAACAATGAGCTTGATGAGAAGTTAGACAAATTTTTCGAACTAGAATCAGTTCCCTCTGCTCAACAAATCCATACTAAAGGTGAGAGTGAGTGTGAACAAATATTTACACAAACAACAAAGCGCCACCCAGATGGCAAATTTATTGTTACCATTCCATTAAAAGGATCACCTGAATCTTTAGGGGATTCCAAACAACAAGCTCTAATTAGGTTTCAATCTTTGGAACGTAAATTTAAACGCAACGCAGAGTTCAAAGAAAAATACACAAATTTTCTTGAAGAATATTTGGCTTTAGGTCACATGTCAGAAAATGAAACAATACAAAACGACTGCATTTCATACTTCATGCCTCATCATGGCGTTTTGCGGGAAAACAGCCTCACTACAAAATTACGTACAGTCTTTGATTGTTCAGCTGTAACAAGCACGGGTTTATCATTCAATGATATTCAACATATTGGGCCCACTGTACAAGATGATTTACTTAGCATATTGATTCGATTTAGACAGCATAAGTTTGTAGTAACGTCAGATATAGAAAAAATGTATAGACAAATTTATGTTAACAATAAACAACGATGTTTGCAACAAATATTTTGGCGATCACACCCCAGCCAGCCAATTAAACAATATAAATTAAACACAGTCACATATGGGACCGCATCAGCACCGTATTTAGCAACTAGATGTCTGGTACAGCTGGGACAAGAATGCACCAATGAGGATGTTCGGGAAGCAATTTTACACGATTTTTATGTAGATGATTATATATCTGGGCATGATGATGAAAAAACTTTAATACAAATATGTAAAGGCGTCATTCAGACGTTAGAAGGCGCACGTTTTCATTTACGTAAATGGCTGTCCAATCAACCGTCTATCCTGGATGATATTGTTAGCGAAAATAATACAGACGAGTTATTAAACTTAAACAAACATGATTATACAAAAACATTAGGTTTACTCTGGGCCTGTAAAAAGGACACATTATTATTTGCAGTAAATAAAATATCAAATCAGCCTAACACAAATAAACGTACAATTTTATCCACAATTGCTCAAGTGTTTGATCCACTTGGTTTAATTAATCCTTGCATGTTACAGGCAAAACTCATATTACAAACACTATGGGCTAAGAATATCACATGGGATGACCAGCTACCTGCTGATGTTGAGTCACAATGGCACGACTTTATTAAATACTTACCAGAAATTACAAAAATAGAAATCCCTCGTAGAGTGTTATGCAATTCGTATGTTAAGGTCGAATTGCACGCGTTTTCTGATGCCTCCATTAAGGCCTATTCAGCTTGTATATATCTACGCTCAGTGTCTGAAACTGGGAATGTACAAGTACATTTGATACTTGCAAAGGGCAGAGTGGCACCATTGAAGCAAAGGCTGACTATGCCAAGGTTGGAGCTTTGCGGCGCCCTTCTCGCTACAAGGTTAACAAAAAAGGTAGTAAATTCATTACGTTTAAACATTGACTCAACATTTTTTTGGTGTGACTCAACTATTGTGCTGGGCTGGATCAAAACATGCAAGTTAAAACTAAAACAATTAAAAGGATCACCTGAATCTTTAGGGGATTCCAAACAACAAGCTCTAATTAGGTTTCAATCTTTGGAACGTAAATTTAAACGCAACGCAGAGTTCAAAGAAAAATACACAAATTTTCTTGAAGAATATTTGGCTTTAGGTCACATGTCAGAAAATGAAACAATACAAAACGACTGCATTTCATACTTCATGCCTCATCATGGCGTTTTGCGGGAAAACAGCCTCACTACAAAATTACGTACAGTCTTTGATTGTTCAGCTGTAACAAGCACGGGTTTATCATTCAATGATATTCAACATATTGGGCCCACTGTACAAGATGATTTACTTAGCATATTGATTCGATTTAGACAGCATAAGTTTGTAGTAACGTCAGATATAGAAAAAATGTATAGACAAATTTATGTTAACAATAAACAACGATGTTTGCAACAAATATTTTGGCGATCACACCCCAGCCAGCCAATTAAACAATATAAATTAAACACAGTCACATATGGGACCGCATCAGCACCGTATTTAGCAACTAGATGTCTGGTACAGCTGGGACAAGAATGCACCAATGAGGATGTTCGGGAAGCAATTTTACACGATTTTTATGTAGATGATTATATATCTGGGCATGATGATGAAAAAACTTTAATACAAATATGTAAAGGCGTCATTCAGACGTTAGAAGGCGCACGTTTTCATTTACGTAAATGGCTGTCCAATCAACCGTCTATCCTGGATGATATTGTTAGCGAAAATAATACAGACGAGTTATTAAACTTAAACAAACATGATTACACAAAAACATTAGGTTTACTCTGGGCCTGTAAAAAGGACACATTATTATTTGCAGTAAATAAAATATCAAATCAGCCTAACACAAATAAACGTACAATTTTATCCACAATTGCTCAAGTGTTTGATCCACTTGGTTTAATTAATCCTTGCATGTTACAGGCAAAACTCATATTACAAACACTATGGGCTAAGAATATCACATGGGATGACCAGCTACCTGCTGATGTTGAGTCACAATGGCACGACTTTATTAAATACTTACCAGAAATTACAAAAATAGAAATCCCTCGTAGAGTGTTATGCAATTCGTATGTTAAGGTCGAATTGCACGCGTTTTCTGATGCCTCCATTAAGGCCTATTCAGCTTGTATATATCTACGCTCAGTGTCTGAAACTGGGAATGTACAAGTACATTTGATACTTGCAAAGGGCAGAGTGGCACCATTGAAGCAAAGGCTGACTATGCCAAGATTTGCAGGCAAAACTTATCAGCCTATCATGGGCAACCTACCTCTACAAAGATTGCAAGCAGACTACCCTTTCAGTAATACAGCTGTGGACTATGCTGGTCCCATCATGATGGCAAACAGAAAAGGTCGTGGCTGTCGGTTGAAGAAGGCATATATTGCCGTTTTTGTTTGCCTGGCAGTGAGAGCGATGCACATAGAACTCGTCACCGACTTAAGTTCTAAAGGTTTCATTGCAGCCTTAAATAGATTTATTGCCCGCAGAGGTAAGCCAGCTGTGATCTACTCCGACAACGGAACTAATTTCGTGGGTGCTTGCAACGAAATAGTTAGGTTTCTAAAAAATCAATCTAACGATATTATTTCATACGGTGCTGAAAACGAAATTAATTTCAAATTTAGTCCAGCCTACAGTCCACATTTTAACGGCGTAGCAGAAGGGTCAGTTAAATCAATTAAAAAACATTTAACTCATGTATTGTCAATGGCTCATTTGGATTATGAAGAGATGAACACTGTATTGGTTCAAATTGAGGCAATACTGAATTCTAGACCTCTCACTCCAATTTCATCTGATCCATCAGATTTAGTTCCTCTTACACCAGCGCATTTCTTGATTGGACGAACGCTCACTATGTTACCTGCTCCCCAGGTCGATGATACTCCAGTTCATATGCTTTCCAGATATAAAAGGATACAATTATTAAAAACACATTTTTGGAATCGATACTACAAGGAGTACGTTTCAGAATTGCAGATCCGAAACAAATGGCGCACAAATAGAGGACAACCACAGCCAGGAGAGATGGTTCTCATTAAAGATGATCGGCTGCCCCCCAATAGATGGCTGCTGGGACGTGTCACCACAGTTTACCCAGGCGCTGACGGCGTCAACCGGGTGGCAGACGTAAAAACTACTTCAGGAACCTTACGCAGAGCTTGGAATAGGCTCTGTCCATTACCAGTTATGTTGGACCAGAAAGATGCATCTGCTCCAAGAGGGCCAGTCTGTTAA
Protein
MDIKSLKKTRSSHKAKLTIFKTYIDSLLPSKRVNEVQAFELKARLDKILDLYNEFDSVQTDLESLVEISDDEHKEREIFENSYFGCVAFAQKMLSAASADQDAGSVTGSNINTGPSGRPNIKLPTINLPIFSGRYQEWLEYHDTYKSLIHDNTTIPKIHKFHYLRNTLKESASYIIKSLEFSAENYDIAWDLLCDRYNNDRILVNNHIQAIFNIPTIVQESSKALRSTIDSVNRNLRALKTLNLPTEHWDIIIIHMVSGKLDPGTLRDWEEKRNNLTRLPTLQDFHTFLKNRADLLETVEESSTYTKQQPSQRRHSDITHNRPKTFVVNQTQKQALFRCPVCKNNHAIYQCMKFKSMPIEMRLDRVKQLNLCTNCLRAGHDEQRCRLSSCKLCTQRHNTLLHNKNTVPEASTSSAGCVVLPTVQEQTQKESSGVTLSSTHHSQVLLSTAMVNIQGCDGQTHKVRVLLDNGSTSSFVTETLRAKLGIRSYSTSLLVQGLNNQSSKITKRCDVTISSLTSSGYTTDVNCFVVPHITQLIPTSQINCNFFFIPSRIHLADPTFSTPSEVQMLLGADIFWDVLQNNHIVLGKNKPTLIETTLGWLVTGSIRSNTKFNTNNTVHCHFLNNNELDEKLDKFFELESVPSAQQIHTKGESECEQIFTQTTKRHPDGKFIVTIPLKGSPESLGDSKQQALIRFQSLERKFKRNAEFKEKYTNFLEEYLALGHMSENETIQNDCISYFMPHHGVLRENSLTTKLRTVFDCSAVTSTGLSFNDIQHIGPTVQDDLLSILIRFRQHKFVVTSDIEKMYRQIYVNNKQRCLQQIFWRSHPSQPIKQYKLNTVTYGTASAPYLATRCLVQLGQECTNEDVREAILHDFYVDDYISGHDDEKTLIQICKGVIQTLEGARFHLRKWLSNQPSILDDIVSENNTDELLNLNKHDYTKTLGLLWACKKDTLLFAVNKISNQPNTNKRTILSTIAQVFDPLGLINPCMLQAKLILQTLWAKNITWDDQLPADVESQWHDFIKYLPEITKIEIPRRVLCNSYVKVELHAFSDASIKAYSACIYLRSVSETGNVQVHLILAKGRVAPLKQRLTMPRLELCGALLATRLTKKVVNSLRLNIDSTFFWCDSTIVLGWIKTCKLKLKQLKGSPESLGDSKQQALIRFQSLERKFKRNAEFKEKYTNFLEEYLALGHMSENETIQNDCISYFMPHHGVLRENSLTTKLRTVFDCSAVTSTGLSFNDIQHIGPTVQDDLLSILIRFRQHKFVVTSDIEKMYRQIYVNNKQRCLQQIFWRSHPSQPIKQYKLNTVTYGTASAPYLATRCLVQLGQECTNEDVREAILHDFYVDDYISGHDDEKTLIQICKGVIQTLEGARFHLRKWLSNQPSILDDIVSENNTDELLNLNKHDYTKTLGLLWACKKDTLLFAVNKISNQPNTNKRTILSTIAQVFDPLGLINPCMLQAKLILQTLWAKNITWDDQLPADVESQWHDFIKYLPEITKIEIPRRVLCNSYVKVELHAFSDASIKAYSACIYLRSVSETGNVQVHLILAKGRVAPLKQRLTMPRFAGKTYQPIMGNLPLQRLQADYPFSNTAVDYAGPIMMANRKGRGCRLKKAYIAVFVCLAVRAMHIELVTDLSSKGFIAALNRFIARRGKPAVIYSDNGTNFVGACNEIVRFLKNQSNDIISYGAENEINFKFSPAYSPHFNGVAEGSVKSIKKHLTHVLSMAHLDYEEMNTVLVQIEAILNSRPLTPISSDPSDLVPLTPAHFLIGRTLTMLPAPQVDDTPVHMLSRYKRIQLLKTHFWNRYYKEYVSELQIRNKWRTNRGQPQPGEMVLIKDDRLPPNRWLLGRVTTVYPGADGVNRVADVKTTSGTLRRAWNRLCPLPVMLDQKDASAPRGPVC

Summary

Uniprot
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF18701   DUF5641
PF05380   Peptidase_A17
PF03564   DUF1759
Interpro
IPR005312   DUF1759        + More
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR008042   Retrotrans_Pao       
SUPFAM
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
1901
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0212499999999999
Exp number, first 60 AAs:
0.00013
Total prob of N-in:
0.00029
outside
1  -  1901
 
 

Population Genetic Test Statistics

Pi
14.545952
Theta
20.007023
Tajima's D
-1.154042
CLR
30.492103
CSRT
0.108144592770361
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号