SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12784
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.559
 

Sequence

CDS
ATGCAGCTCGGTCGCCCACTTAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCCTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACAGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACCGCGATCATAAGATCTTCTAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGAGCTTAGGGATCTCTTAAGAGTCAGGAACGCGGCAATCTGGGCCCACGATCGATATCCCACGGATTCAAACCGGGCTCGGATGCGTCGCCTACAGCGGGAGGTCAAATCCCGCCTAAGCGACGCCTGTAATGAAAATTGGGATAGTTACTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAAGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAGGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGATCACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAACTTCCCTGCCGCCCTCGGACGTGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAACCTGCAACCACGGAAAGCTCCCGGATCCGACGGCATCCGCAACCGCGCGCTTAAATTATTACCAGCCCAACTAATAACGATGTTGGCCACCATTTTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCTGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTCGCGTCCAACAAAATATTGATCGACGAGCAGTTTGGGTTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAATAGGCGGAAACCCATCCCGACAGGAGCCCCCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCAATATCGAGTCGAGGGAACGCGTTTCCGCCCCCGTCACATCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGCATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGTTGAGCATCCCTCTTCCGTCTCGGCGCGTCGACACCTCCGCCTCCGCCATTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCACCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGAAGGATGATATTCCGCCCCCATATTAAGACGGTACGCGATCGTGCCGCCTTCATTCTAGGCCGTTTCTACCCGAGGATATGCAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCACACGCCCAGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTCACTTAAAATCCTTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGATCTGGACTTAGAGTCCATCAGTAAGTATCTACAGTCGGCGTCGATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTCTAGGACTAACTTACGGCCCATCTGATGGTGAGCGGTGA
Protein
MQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPELRDLLRVRNAAIWAHDRYPTDSNRARMRRLQREVKSRLSDACNENWDSYLEELAPTHQAYWRLARTLKSETIATMPPLVRPSSQSPAYDDDDKAELLADALQEQCTTSTQHADPDHTELVDREVERRTSLPPSDVLPPITTSEVKEAIDNLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVASNKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGAPFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFQYRVEGTRFRPRHITAGVPQGSALSPLLFSLHINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPSRRVDTSASAIRPITMFDQPIPWAPKVKYLGVTLDRRMIFRPHIKTVRDRAAFILGRFYPRICRRSKMSLRNKVTLYKTCTRPVMTYASVVFAHAARTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGLTYGPSDGER

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    S59870    AAB26437.2    GGMS01006359    MBY75562.1    RPOV01000134    RPJ78669.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    GFXV01007093    MBW18898.1    ABLF02042518    ABLF02057746    GFTR01008038    JAW08388.1    NEVH01006736    PNF36716.1    GBBI01001646    JAC17066.1    GGMR01018716    MBY31335.1    NEVH01006721    PNF37225.1    ABLF02033757    NEVH01026386    PNF14434.1    GGMS01002955    MBY72158.1    GGMS01002992    MBY72195.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GGMR01003407    MBY16026.1    ABLF02024246    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    ABLF02008463    JRES01000644    KNC29657.1    GEZM01053022    JAV74219.1    GBGD01000880    JAC88009.1    GFTR01008256    JAW08170.1    GFTR01008271    JAW08155.1    GFTR01008251    JAW08175.1    GBGD01000799    JAC88090.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    GGMS01017365    MBY86568.1    GGMR01012305    MBY24924.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01006408    MBY19027.1    GGMR01000676    MBY13295.1    NEVH01020940    PNF20481.1    NEVH01016302    PNF25823.1    GFTR01008262    JAW08164.1    NEVH01000269    PNF43694.1    NEVH01005938    PNF38077.1    LBMM01014395    KMQ85192.1    KK119692    KFM76444.1    NEVH01003017    PNF40781.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    GBBI01001570    JAC17142.1    GGFJ01001858    MBW50999.1    GGMR01000857    MBY13476.1    GGMR01014053    MBY26672.1    GGMS01004444    MBY73647.1    GBBI01003810    JAC14902.1    GBGD01000389    JAC88500.1    NEVH01010546    PNF32261.1    GFDF01007661    JAV06423.1    NEVH01017542    PNF24034.1    GGMR01000005    MBY12624.1    NEVH01020071    PNF21969.1    JXUM01014072    KQ560393    KXJ82651.1    NEVH01023962    PNF17612.1    NEVH01019964    PNF22161.1    NWSH01000032    PCG80496.1    GGFJ01001857    MBW50998.1    NEVH01001355    PNF42855.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00717085,     Score=95

Ontologies

Topology

Length:
726
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.29527
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00882
outside
1  -  726
 
 

Population Genetic Test Statistics

Pi
0.320249
Theta
11.51277
Tajima's D
-1.701207
CLR
41.538952
CSRT
0.0350482475876206
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号