SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12778
Pre Gene Modal
BGIBMGA013095
Annotation
reverse_transcriptase_[Operophtera_brumata]
Location in the cell
Cytoplasmic   Reliability : 2.434
 

Sequence

CDS
ATGGCTCAACTTATAGGAAACATATCTGAGTTTGATTATAAAACCCAAGAATGGCAGATCTTTTACAAGAAATTAGAAAATTTCCTAAAGTTGAACAAAGTTTTAGCTGAAGATTGGTGCTCCGTGCTTATTGCACATCTTTCAGATGATTCGTATCGGCTTGTGAGGAACCTCGTACATCCTAAGGAGGTAGAAATAGTACAATGGACTGAGCTGGTTAGAGTACTCAACGGACATTTTCAACCGAAAAGATCGACTTTTGCCGACAGGGCAAAATTTTATGGTGCGATCAGAATGGACGGTGAGAAAGTCGAAGATTGGGCGGCACGTCTGAGGGGACTCGCCGTGCACTGTAATTTCGGTACAGAATTAGATACGTTGCTACGTGATCGATTTATTCTAGGCCTGAAAGTAGGTCCAGAAAGAGATCGATTGTTCGAACAAGACTCGAACTCCCTAACGCTTTCGAGAGCTATTGAAATAGCCCAGGAGACTGCGTGTGCGCGGGCGGCGAGAGCTGATGTTGATGGTAGTGAGCAGCTTATCAAACAAGAGATGGTGTATCGTGTCAGCGAGCGTCGGGCGCGGGGCGCCTCGGCGCAGGCGGAGTCGTCGTGGGCATCGGCTGCAGCCGCGCGCTGTGCAGTGTGCGGGTTGAAAGGTCATTCCGTAGAAAAGTGCCGTTTCAAAGACTATAAGTGTATGATTTGTGGTAAAAAGGGTCACCTTAAGAAAGTGTGCAGTGTCAAAAAGGTCGGAAAACTGTCGTTAAATAATATGGATGATAACGAAAGTGATGGACACGAATGTAAAAAATGTGATTTGTATAATTTAAGGTATGTTCGCTACGATCCTATTAAGTTGAACATTTCTATAAATAATAAGTTTTATTCTATGGAATTAGATTGCGGAGCTGCTCGTAGTGTAATTTCAGAAAGATTTTACAGGGATAACTTCCCATTATACAAATTAATTAGAGCGGAATACCAAGAGGTGCAGCAGATCTTGAATGAATTCCCTGACATTTGGAGAGATGAATTGGGCCGTTTTAATAAATATGAAGTGCATTTACACTTGAAAGAAAATACAACACCTAAATTTTTTAAGCCACGCCAAATACCGTTTGCTCTAAAGGACAAGGTTGAAGAAGAATTACATAGGCTTGTCGAAGCAGGTATATTAGTACCAGTACAGTTTTCAGATTATGCTACGCCCATAGTACCAGTTCTGAAGGAGAATGGTAAAGTGAAAATAGCTGGAGATTTTTCCTGTACCCTAAATAAAGTTTTAAAAATTGACAAATATCCATTACCCCACATAGACGAGGTTTTCGCGAAGTTAGGCGGCGGCGAGCATTATTCTAAGCTAGATTTAAGTAATGCCTATAATCAAATTTGTTTGTCTCAAGCCTCTCAAGACCTCACAACTATAAATACACCGAAAGGACTTTTCAAATATACACGCTTAGTGTACGGTCTCGCGAATGCCCCAGCTATTTTCCAGCGCACAATAGAATCTCTAGTAGTAGGTATTGAAGGAGTGTCGTGTTGGAATTTTATTCCTAATGCATCCTCATTATTAAGTCCGCTGAACGAATTATTAAAAGACGACATAAAATGGCACTGGGATAAGCGACAGCAGCTTGCGTTTGATTCCGTGCGAAAAGAACTCGCCTCGGACCGCGTACTATCACATTTCGATCCGAGGGCGCAGCTAACATTGACAGTGGATGCGGGCCCGTCTGGTCTCGGCGCGGGGGAGGATGAGGAGGGCGATGAATGGGAGGAGGCTAGTGAAAACATCGCAGCTGCCAGCCTGCCGACCGAGTGTGAACCTGATTACCCTATTGTAGCATCAGATGACCCCGATAACGTGAGATTAGAAGAGAGGGCGCCAGATAATGAAAGACAGTGTGGTCGACCAAAGAGGACAAGAAAAGTAGTAGATTATAAGAAGTATTTTTAA
Protein
MAQLIGNISEFDYKTQEWQIFYKKLENFLKLNKVLAEDWCSVLIAHLSDDSYRLVRNLVHPKEVEIVQWTELVRVLNGHFQPKRSTFADRAKFYGAIRMDGEKVEDWAARLRGLAVHCNFGTELDTLLRDRFILGLKVGPERDRLFEQDSNSLTLSRAIEIAQETACARAARADVDGSEQLIKQEMVYRVSERRARGASAQAESSWASAAAARCAVCGLKGHSVEKCRFKDYKCMICGKKGHLKKVCSVKKVGKLSLNNMDDNESDGHECKKCDLYNLRYVRYDPIKLNISINNKFYSMELDCGAARSVISERFYRDNFPLYKLIRAEYQEVQQILNEFPDIWRDELGRFNKYEVHLHLKENTTPKFFKPRQIPFALKDKVEEELHRLVEAGILVPVQFSDYATPIVPVLKENGKVKIAGDFSCTLNKVLKIDKYPLPHIDEVFAKLGGGEHYSKLDLSNAYNQICLSQASQDLTTINTPKGLFKYTRLVYGLANAPAIFQRTIESLVVGIEGVSCWNFIPNASSLLSPLNELLKDDIKWHWDKRQQLAFDSVRKELASDRVLSHFDPRAQLTLTVDAGPSGLGAGEDEEGDEWEEASENIAAASLPTECEPDYPIVASDDPDNVRLEERAPDNERQCGRPKRTRKVVDYKKYF

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF00078   RVT_1
PF17921   Integrase_H2C2
PF00665   rve
PF13683   rve_3
PF17917   RT_RNaseH
PF05485   THAP
PF00378   ECH_1
PF00077   RVP
PF00098   zf-CCHC
PF00041   fn3
PF03564   DUF1759
PF05147   LANC_like
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR034128   K02A2.6-like       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
IPR006612   THAP_Znf       
IPR001969   Aspartic_peptidase_AS       
IPR001753   Enoyl-CoA_hydra/iso       
IPR029045   ClpP/crotonase-like_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR003961   FN3_dom       
IPR013783   Ig-like_fold       
IPR036116   FN3_sf       
IPR005312   DUF1759       
IPR012341   6hp_glycosidase-like_sf       
IPR020464   LanC-like_prot_euk       
IPR007822   LANC-like       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF52096   SSF52096       
SSF49265   SSF49265       
Gene 3D
PDB
4OL8     E-value=2.20389e-16,     Score=211

Ontologies

Topology

Length:
654
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00322
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00029
outside
1  -  654
 
 

Population Genetic Test Statistics

Pi
11.035767
Theta
12.01733
Tajima's D
-0.646562
CLR
3.65391
CSRT
0.214689265536723
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号