SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12772
Pre Gene Modal
BGIBMGA007154
Annotation
PREDICTED:_monocarboxylate_transporter_14-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.88
 

Sequence

CDS
ATGGTTGAAACAGACGGTACCGGTGGTGAATCAACCGAAAAAAACAGTAAAATAGTTAGTAATAACAGGGTTATCAACAATGCTAACGATCGTCTTGATCATGATGTCATAGCGCAGTACACTAAGGAAACAGAGCCTGAATTGCTGCTTGAAAAAGTAAAATTTGAAGGACTTGATGATGAAAAGATCACACGTAGGGATGCAGTCACTGCAAGAAAGATACCTGACGGTGGCTGGGGTTGGGTGGTAGTGGCTTCGGCGTTCCTTGTCTCCGCCTGCGCTGATGGTCTCGCCTTCTCTTTCGGACTCCTCCACGAAAGGTTGACCAGCTATTTCAACACAACACAATCAAAGACCTCATTAATAGGAAGCCTGTTTATAGCCACTCCGCTACTAGCGGGACCGGTAATGAGTGCTTTGGTCGACAGATATGGCTGTCGAGTTATGACTATAATTGCCGGGCTGCTGTCAACGGTAGGGTTTCTGTTAGCAGCTGTGAGTAACTCAATCGGCATGCTGTGTTTGACGTATGGTTTCATAAGCGGTTTAGCTATGGGGATTATGTACGTAACCGCAGTGGTGTCTGTAGCCTTTTGGTTCGACAAAAGAAGGAATCTGGCCGTTTCGTTAGCGTCATGTGGTGTTGGTTTTGGGACGCTGCTTTATTCGCCGATGACCAGCTACTTTTTGGAACTCTACGATTGGAGAAGCACAATAATATTGCTTGCTGGAACGTTGTTGAACATGTGCGTCTGCGGCGCTCTGATGAGAGATCCAGAGTGGCTTATAATTAAACAGGAAAGAGAAAGAAGAGCGTCCAGATCGAAGTCTAGGTCTGCTAGTCTTTCATCGAGAGCCTCGAGTCAAGATTCATTGTTTCTTGGAGCCGACGAAATCAAATCTTTGCTTGAGAGCGGTCAAAGTCCTGAATATATACTAGCAACGTTGGCTTCCAGTATAGCCGAGGCTGAAGAGTTGGAGAGCACAACACAAGCCAATGTTGAGCAATCTTTTAAGAGGATGCATTCGGCGATACAGCTGCCGACATTCATTCAGCAAAAAGAAAAGGTACCGCCAGAAGTAATGGAAAAATTAATGCACAATAAGAAAATTTACAATATAATAGTAAACAATTATCCTGACTTAATTGCAAGGAGGAAATCTGAAGCCAGTATAAACGTTGAATCTCCAACTGCGGATGTCGTCACAGAAGCAGCTGTAATCCCAGTTGAAATACAGGCTATAGATCTTAAAGCGTCTGGATCCAACGCTCACAATACCGAAGATAAGAAAAAAACCTCAAAAGAAACGAATAAGGCCAAAGATAATGCAAAGAATCAATCCAAAACAGTGCCACCGCAACAGAATTGGTTCAGACAAATATCTATGGACCACCATTATTTGAGAGATGTGCCACTATACAGGAACACGATGATGCGACGCGGGGCCATGATGAGTATCCAGCGCTACCGGCTGAGGGCTGCTTCGTTGCCGGACATGTACAAGAATACAACGGATTCGGAGTCGGATGATGAGTCAGAATGGTACGAGCGCTTCGTCAGCGTCCTCAAATCAACATTCGACTTCCGAATGTTCACGGAGTTCCATTTCTTGATGTTCAACCTCTCCTCCCTCATCCTCTCAGTGTGGTTCATTGTTCCTTACTTCTTTCTTAACTCCTACATGTCGAGCCAAAGGATGGACGGTGGTGCTACGATGATCAGTATCATTGGAGTCGCTAGCAGTATTGGAATTGTGGCTCTTGGTTGGGCTGGAGATCAGCCATGGATCAACGTCACCAAGACATACGCGGTCTGCCTCATTATCTGCGGCTTCTCCGTCGCGGCCTATCCCCTCTTCATCACTAACTATTGGGCACTGACTGTGATCTCCACGGTTTTCGGCCTATCATTTGCCAGCTCTTACTCCTACACTCCGACGATCTTGATGGAGCTCATGCCTATTGATCATTTTACCGTGGCCTATGGTCTCATCCTGCTCAGTCAAGGGATCGGTCATCTGGTCGGGCCACCTCTAGGCGGTTTGTTGTACGACTTGACCGGTGCCTGGGACCTCACATTCTACGTGGGCGGAGTGTGGCTGGTGGTATCAGGACTATGTGTAGGAGTCATCCCTTACACCAAAGACAAGAGGATGTGTGGGGCTGCGCCTCTACTGAAAGAGTCAACGGAGGTGGTGAATGTCTGA
Protein
MVETDGTGGESTEKNSKIVSNNRVINNANDRLDHDVIAQYTKETEPELLLEKVKFEGLDDEKITRRDAVTARKIPDGGWGWVVVASAFLVSACADGLAFSFGLLHERLTSYFNTTQSKTSLIGSLFIATPLLAGPVMSALVDRYGCRVMTIIAGLLSTVGFLLAAVSNSIGMLCLTYGFISGLAMGIMYVTAVVSVAFWFDKRRNLAVSLASCGVGFGTLLYSPMTSYFLELYDWRSTIILLAGTLLNMCVCGALMRDPEWLIIKQERERRASRSKSRSASLSSRASSQDSLFLGADEIKSLLESGQSPEYILATLASSIAEAEELESTTQANVEQSFKRMHSAIQLPTFIQQKEKVPPEVMEKLMHNKKIYNIIVNNYPDLIARRKSEASINVESPTADVVTEAAVIPVEIQAIDLKASGSNAHNTEDKKKTSKETNKAKDNAKNQSKTVPPQQNWFRQISMDHHYLRDVPLYRNTMMRRGAMMSIQRYRLRAASLPDMYKNTTDSESDDESEWYERFVSVLKSTFDFRMFTEFHFLMFNLSSLILSVWFIVPYFFLNSYMSSQRMDGGATMISIIGVASSIGIVALGWAGDQPWINVTKTYAVCLIICGFSVAAYPLFITNYWALTVISTVFGLSFASSYSYTPTILMELMPIDHFTVAYGLILLSQGIGHLVGPPLGGLLYDLTGAWDLTFYVGGVWLVVSGLCVGVIPYTKDKRMCGAAPLLKESTEVVNV

Summary

EMBL
BABH01031609    NWSH01000554    PCG75685.1    KZ150013    PZC75044.1    KQ458981    + More
KPJ04472.1    KQ460882    KPJ11474.1    ODYU01004928    SOQ45305.1    BABH01031610    RSAL01000317    RVE42585.1    JTDY01003280    KOB69810.1    AGBW02008415    OWR53453.1    NWSH01007033    PCG63126.1    KZ149921    PZC77732.1    RSAL01000304    RVE42716.1    ODYU01000260    SOQ34727.1    KQ459603    KPI93154.1    KQ460124    KPJ17668.1    BABH01037649    AGBW02014130    OWR42229.1    GECZ01022618    GECZ01008634    JAS47151.1    JAS61135.1    GEBQ01017028    GEBQ01016920    GEBQ01012615    GEBQ01001956    JAT22949.1    JAT23057.1    JAT27362.1    JAT38021.1    GECU01028486    GECU01022863    GECU01016348    GECU01008024    JAS79220.1    JAS84843.1    JAS91358.1    JAS99682.1    GEDC01021494    JAS15804.1    GEDC01013652    JAS23646.1    KQ435732    KOX77337.1    GL444372    EFN60961.1    GECZ01021235    JAS48534.1    NEVH01009422    PNF33023.1    KZ288212    PBC32804.1    PYGN01000790    PSN40793.1    GL888062    EGI68511.1    DS235115    EEB12167.1    NNAY01001665    OXU23277.1    KQ981189    KYN45223.1    GEZM01099141    JAV53466.1    KQ978820    KYN28133.1    KQ976595    KYM79626.1    GL771849    EFZ09427.1    KQ982365    KYQ57127.1    LBMM01005754    KMQ91230.1    KQ779356    OAD51997.1    GFXV01004536    MBW16341.1    ABLF02030750    GGMR01004731    MBY17350.1    KQ459435    KPJ01099.1    KPI93156.1    QOIP01000010    RLU17786.1    KK107167    EZA56497.1    KQ971361    EFA08671.2    ODYU01001747    SOQ38363.1    GL448543    EFN84342.1    BABH01037651    KQ434924    KZC11585.1    KPJ17669.1    PZC77733.1    RVE42717.1    KQ977279    KYN03989.1    APGK01038973    KB740966    KB631578    ENN76910.1    ERL84404.1    GFTR01007370    JAW09056.1    OWR42228.1    APGK01038976    APGK01038977    APGK01038978    APGK01038979    ENN76911.1    ACPB03014175    JTDY01005603    KOB66842.1    GEDC01030362    GEDC01016970    JAS06936.1    JAS20328.1    EFN60962.1    EFN84344.1    GBHO01025619    GDHC01000641    JAG17985.1    JAQ17988.1    GFTR01007803    JAW08623.1    PNF33024.1    KZC11586.1    OAD51996.1    GANO01004466    JAB55405.1    LBMM01005457    KMQ91497.1    KQ414855    KOC60127.1    ADTU01022996    KYQ57128.1    KYM79627.1    GFDF01009381    JAV04703.1    GFDF01009380    JAV04704.1    GFDF01009382    JAV04702.1    GFDF01009383    JAV04701.1    EZA56496.1    RLU17785.1    GANO01004465    JAB55406.1    EFZ09435.1    CVRI01000053    CRK99823.1    GEZM01042994    GEZM01042993    JAV79402.1    GEDC01029848    JAS07450.1    UFQS01000367    UFQT01000367    SSX03211.1    SSX23577.1    GECZ01002733    JAS67036.1    PNF33018.1    EEB12161.1    GGMS01007197    MBY76400.1    ERL84402.1    EFA08184.1    JH431250    KK853278    KDR09062.1    SAUD01019071    RXG58329.1   
Pfam
PF07690   MFS_1
Interpro
IPR020846   MFS_dom        + More
IPR036259   MFS_trans_sf       
IPR011701   MFS       
SUPFAM
SSF103473   SSF103473       

Ontologies

Topology

Length:
735
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
257.45876
Exp number, first 60 AAs:
0
Total prob of N-in:
0.99194
inside
1  -  76
TMhelix
77  -  99
outside
100  -  118
TMhelix
119  -  141
inside
142  -  147
TMhelix
148  -  167
outside
168  -  176
TMhelix
177  -  199
inside
200  -  205
TMhelix
206  -  228
outside
229  -  237
TMhelix
238  -  255
inside
256  -  536
TMhelix
537  -  559
outside
560  -  568
TMhelix
569  -  591
inside
592  -  602
TMhelix
603  -  620
outside
621  -  623
TMhelix
624  -  646
inside
647  -  657
TMhelix
658  -  677
outside
678  -  691
TMhelix
692  -  714
inside
715  -  735
 
 

Population Genetic Test Statistics

Pi
23.663891
Theta
21.744594
Tajima's D
0.201683
CLR
0.647774
CSRT
0.434278286085696
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号