SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12769
Pre Gene Modal
BGIBMGA006410
Annotation
endonuclease-reverse_transcriptase_[Blattella_germanica]
Location in the cell
Nuclear   Reliability : 2.243
 

Sequence

CDS
ATGGAAGCTCAAAGAAAAACCAGACAAGTTATAAGAACAGCCAAGCGAGAGCACATGAATGACATCATGAAGAATATGGAAAACCTGATAAGAACGAATGAGGCTCGAAAATTCTACCAGGAAATAAGATCGGTAAAGAAGGCATACCAACCAATCGCACAATTTCTTGAAGACGAAGACGGAAATCTTGTGACTAACATTCGTGAGATCAGTGTAATGTGGCGTCAGTACTTTCAAAACCTTCTGAATTGCCCTCCACCGACGGAAGATTTAGATGACAACCCCCAAGATCCTGCGGAGGAAGAAGAAGTGGAGCCACTGAACTTCGAAGAAATAAAAAACGCTATTATGAGGCTTAAGAACAACAAAGCGCCAGGTATTGACAACCTACCATCTGAACTGTGGAAATACGGCGGAGAAGCCTTGCAGTCCAGATTGTACAATCTTATTAAAATGATATGGGAATCTGAACAACAACCTGTCCAGTGGTATTCGGGGGTCATCTGCCCCATACACAAAAAAGGCAGCCGGAAGAAATGCAGTAACTACAGAGGAATTGCTTTACTACCTACAGCGTACAAAATACTGTCATACGTTTTACTAAGCAGGTTAGAGCCGTATTCAGACAAAATCATTGGGGATTATCAGTGCGGCTTCAGACGTAATCGTAGTACAGTCGACCAAATCTTTACTCTGAAACAGTTAATGGAGAAAAGATGGGAGTATGCACAAAGTATTCATTCGCTCTTTGTTGATTTTGCTAAGGCCTACGACAGCATAGATAGACCGACTCTATATAGAATCCTCACGCGCTTTAAAATCCCACAGAAACTTGTGAGAATGGTGGAGGTTGCTACTAGGGAAAGTAGAATGACGGTACGAGTTGGCGCTTCTCTCACTGATGAGTTTGACGTTGTGACTGGACTCAGGCAGGGGGACGCTCTGTCACCAATGCTGTTCAACCTGGCACTTGAACACGCCATACGGAAAGTGAACACACTTAGTGGCGGAGTGTGGCTCAACGGACAGCATAGGGTGATAGGATATGCCGATGACCTCGCTCTACTTGGAGAAAGAAAGCAGCACGTTATAGACGCACTCAACTGCCTCCAACAAGAAGCCTCTCGGATTGGCCTTCGCGTGAGCCACGAGAAGACAGAATATCTTCACATGCGTCGATATAAAAACGTAAGACGGAAGCGAGAAGACCTAGTGGTGGGAAATACGAGGTTCAAAGGAGTGGCTAAATTCCGGTACCTTGGCTGCACTGTAACAGACACCAATGACAGGGAAGATGAAATCGAAATTCGTATACAAAATACCCTACGATGCAGTGCAGCCCTACACCCGGTTCTCTCTTCGAAGCTACTAAGCAGGCGCACCAAGATTCGGATATACAAGACTCTAGTCAGACCGATCCTATTGTATGGATGCGAAGCATGGACGCTCACACAGAAAGAAGAGGCAAAACTTCTCGTGACGGAGCGAAAGGTATTGAGAAAAATACTAGGACCAGTTCGGAAAGAAGACGGTTCTTGGCACGTCCGGAAAAATAAGGATGTGGAGAGGCTTTTTGGTGAGCCAAATATTCTGGGGGAGATGAAGGCACGGAGGCTCGGATGGCTCGGACATGTAGTACGTATGGAGCAGGATCGGGCTGTGAAACGGGTGTACACGGGTGTACCGGAGGGACGCCGCCCCGTAGGGAGGCCCAAGTACCGCTGGTGTGACGCTGTGGAAGGAGATTTACGGGAGCTCCAAGTGTCGGACTGGCAAGGTGTTGCGCAGCGCCGGGATGAATGGCAAAGTTTATTGTCGGAGGCCAAGACCCACTTCGGGGTCATAGCGCCAGCTCAGTAG
Protein
MEAQRKTRQVIRTAKREHMNDIMKNMENLIRTNEARKFYQEIRSVKKAYQPIAQFLEDEDGNLVTNIREISVMWRQYFQNLLNCPPPTEDLDDNPQDPAEEEEVEPLNFEEIKNAIMRLKNNKAPGIDNLPSELWKYGGEALQSRLYNLIKMIWESEQQPVQWYSGVICPIHKKGSRKKCSNYRGIALLPTAYKILSYVLLSRLEPYSDKIIGDYQCGFRRNRSTVDQIFTLKQLMEKRWEYAQSIHSLFVDFAKAYDSIDRPTLYRILTRFKIPQKLVRMVEVATRESRMTVRVGASLTDEFDVVTGLRQGDALSPMLFNLALEHAIRKVNTLSGGVWLNGQHRVIGYADDLALLGERKQHVIDALNCLQQEASRIGLRVSHEKTEYLHMRRYKNVRRKREDLVVGNTRFKGVAKFRYLGCTVTDTNDREDEIEIRIQNTLRCSAALHPVLSSKLLSRRTKIRIYKTLVRPILLYGCEAWTLTQKEEAKLLVTERKVLRKILGPVRKEDGSWHVRKNKDVERLFGEPNILGEMKARRLGWLGHVVRMEQDRAVKRVYTGVPEGRRPVGRPKYRWCDAVEGDLRELQVSDWQGVAQRRDEWQSLLSEAKTHFGVIAPAQ

Summary

EMBL
PYGN01000064    PSN55609.1    PYGN01000451    PSN46127.1    PYGN01001382    PSN35227.1    + More
HE799691    CCH14900.1    PYGN01000047    PSN56294.1    PYGN01000020    PSN57453.1    PYGN01000203    PSN51319.1    PYGN01000324    PSN48495.1    PYGN01000219    PSN50892.1    PYGN01000502    PSN45243.1    PYGN01000070    PSN55417.1    PYGN01001004    PSN38555.1    PYGN01000510    PSN45119.1    PYGN01001494    PSN34463.1    AJVK01001578    GBBI01004263    JAC14449.1    GDAI01000742    JAI16861.1    PYGN01000107    PSN54137.1    LBMM01005351    KMQ91586.1    GGMR01006433    MBY19052.1    QOUI01000020    RCK67885.1    KU311054    ALX81665.1    PYGN01000613    PSN43351.1    GGFK01002192    MBW35513.1    GBRD01000202    JAG65619.1    GGFK01002196    MBW35517.1    GBBI01004198    JAC14514.1    GGMR01014652    MBY27271.1    PYGN01000629    PSN43121.1    PYGN01000287    PSN49259.1    FJ265555    ADI61823.1    PYGN01000119    PSN53667.1    GBBI01004261    JAC14451.1    GGFK01001949    MBW35270.1    GGFK01005184    MBW38505.1    ABLF02027703    ABLF02061609    GDHC01021627    JAP97001.1    GGFK01001798    MBW35119.1    GGFK01003613    MBW36934.1    PYGN01000254    PSN50032.1    PYGN01003402    PSN29545.1    GGFL01003846    MBW68024.1    ABLF02066124    GGFL01003845    MBW68023.1    QOIP01000009    RLU18885.1    GBBI01004199    JAC14513.1    GBGD01000331    JAC88558.1    CH902619    KPU76535.1    GECL01002632    JAP03492.1    PYGN01000372    PSN47498.1    GGFK01003183    MBW36504.1    CH902653    KPU74858.1    ABLF02039015    GECL01001585    JAP04539.1    GBRD01011073    JAG54751.1    GGMR01020071    MBY32690.1    NEVH01019065    PNF23216.1    CH902657    KPU75308.1    CH902621    KPU81727.1    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    CH904714    KPU81814.1    IAAA01017079    LAA06070.1    GGMR01000126    MBY12745.1    GGMR01016675    MBY29294.1    PYGN01000082    PSN54842.1    CH902626    KPU79149.1    PYGN01000580    PSN43876.1    ABLF02019047    ABLF02019049    GGMR01010991    MBY23610.1    GALA01001775    JAA93077.1    ABLF02036907    ABLF02036915    ABLF02036922    ABLF02041419    GBRD01017846    JAG47981.1    PYGN01000078    PSN55011.1    PYGN01001465    PSN34679.1    GBBI01004262    JAC14450.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1    ABLF02018097    ABLF02043469    ABLF02056908    PYGN01000212    PSN51056.1    GAPW01000107    JAC13491.1    CH902714    KPU81861.1    ABLF02010115    ABLF02030763    ABLF02005950    ABLF02005951    ABLF02003651    ABLF02007294    ABLF02007295    ABLF02056183    CH902627    KPU74872.1    GAPW01000199    JAC13399.1    GGMR01000301    MBY12920.1    CH902628    KPU75346.1    ABLF02020712    ABLF02020717    ABLF02054820    CH902623    KPU72899.1    CH902618    KPU79125.1    ABLF02026145    ABLF02026146    ABLF02042729    CH902666    KPU74610.1    ABLF02018925    CH902633    KPU74667.1    CH902622    KPU75266.1    KPU77326.1    CH902630    KPU77522.1    GGMR01011466    MBY24085.1    ABLF02003877    ABLF02042991    GEZM01048836    JAV76363.1    GAPW01000120    JAC13478.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF17919   RT_RNaseH_2
PF05699   Dimer_Tnp_hAT
PF13359   DDE_Tnp_4
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR027806   HARBI1_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
619
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.16481
Exp number, first 60 AAs:
0
Total prob of N-in:
0.20572
outside
1  -  619
 
 

Population Genetic Test Statistics

Pi
15.527612
Theta
18.874603
Tajima's D
-0.660436
CLR
3.955404
CSRT
0.2024398780061
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号