SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12758
Pre Gene Modal
BGIBMGA007199
Annotation
PREDICTED:_uncharacterized_family_31_glucosidase_KIAA1161-like_[Amyelois_transitella]
Location in the cell
Lysosomal   Reliability : 1.481
 

Sequence

CDS
ATGGACGCCAAAATATTCTTACTACTGTTATCGACAGTAGTATTTGTCAATGCTGTAGACATATCACTCATAGACTCGACTGACGTCAAATTGAAACTACAAGACAACCCATATGGAGGACTTAACGTACTTTTAAATAGAAGAGGCATTTCAGAAGTGATTTCAGTCATAGGACGTCGAACGTCTGGCATAAAGGACATAATTCAGAACGGCGACGTATTGATCCAGTTCAAAAACGACACCACGGTCAGAATCAGTGTCGAGCATATCGCGGGTGAGAGGAAAGGTCACCTGCTGTCGTTCGCTTGGAAAACAACAAAGAACACCCGACTGGAGGACTGTGCTAATCTCGGCACCGACAGCTGGTATGGAGGCCCGCAACAAAAACGCCAATACTGGCCCATCGAGAGACTCGTTCTCCCGAACTACTCGTATGTGACCAAGGAAGCGGACAACAGTGCTGTAGCCGAGCCTTACTGGCTCAACTCCCAGGGCATATTTTATTACTTCGACAAAAAAGTCCCATTATTCATTGACCAAAACGACTTAGAAAAGAATGCCGCTTGCTTCATAGCTCAGATCAGACCCCCGTATTCAAAGAATAGAGAGAGCAACGAACTCGTATACGCTTTAGGCATCTTCGGTGACGTCAAACAGGCCCATCAATTCGCAGTAGAGAAATATTTGAACAAGCCCAAAGCGATTCCTGATGAGCGAATGATAAAGTACCCTATATGGTCAACCTGGGCCAGGTACAAAAGGGACGTGAACCATGACGTTGTATTAAAATTCGCCGATGAAATAAATAAAAATGGTTTTCCTAATAGTCAAATGGAAATCGACGATCTATGGGAGATTTGTTATGGTTCCCAAACTGTTGATATTAGAAGATTTCCCGACATGAAAGATATGGTTGGAAAACTCAAAGCTAAAGGTTTCCGGGTGACGCTTTGGACCCATCCATTTATAAACAAAGGTTGCGAGCCATGGTATTCTGAAGCCAAAGCGAAGGGTTATTTAGTTTCTTCTGAATACGGTTCAGTGGAAACGAGCTGGTGGAACGACAATGGCACCACCACATCATACATTGATTTCACCAAACCTGACGCCCGCCAGTGGTACGTGGACAGGCTGCGCGCTCTTCAAAAGTCTAATGGAATCGACAGTTTTAAATTCGATGGAGGAGAATCGAGTTGGTCTCCACAAATACCCGTCCTTCGAGGGGACATCAGAGACCAACCTGGTGTAATCACTGCCGACTACGTGAGGGCTGTGGCTGAGTTCGGCCCGATGGTAGAAGTCAGAGCTGGATACAGGACCCAAGACCTCCCGGTCTTCGTGCGAATGATAGACAAGGACAGCTACTGGACCTTCGAGAATGGTCTTCCGACCGTCGTGACCACTTTGCTGCAGATGAACATGAACGGTTACCCCCTAGTCTTACCTGACATGATCGGAGGAAACGGGTACAACGAACCACCGACTAAAGAGTTGTTCATCAGGTGGCTCCAAGCCACAACGTTTATGCCTAGCATGCAGTTCAGCTATGTACCCTGGGACTTCGATAATGAGACAATTGAAATTAGCCAGAAATACGTGGCGCTCCACGCGAAGCACGCGGTCGACATTGTGGCCGCCTGCAAGCAAGCTACCCTGGACGGTACTCCTGTAAACCCTCCGATATGGTGGATCGCGCCCAACGATACCACAGCCTATGATATTTGGGATGAATATCTCCTGGGTGAGGGGATCTTGGTGGCCCCGGTGTTAGAGCGGGGGGCGAGGTCGCGTGACGTGTACTTGCCCCCGGGGACGTGGTTAGCGCAGGGAGACCCCGGCCGGGTGTTCCCCGGAGGCGACTGGATAAGAAAATACCCGGCACCTTTAGACACCTTACCGTATTTCATTCGGGCTTAA
Protein
MDAKIFLLLLSTVVFVNAVDISLIDSTDVKLKLQDNPYGGLNVLLNRRGISEVISVIGRRTSGIKDIIQNGDVLIQFKNDTTVRISVEHIAGERKGHLLSFAWKTTKNTRLEDCANLGTDSWYGGPQQKRQYWPIERLVLPNYSYVTKEADNSAVAEPYWLNSQGIFYYFDKKVPLFIDQNDLEKNAACFIAQIRPPYSKNRESNELVYALGIFGDVKQAHQFAVEKYLNKPKAIPDERMIKYPIWSTWARYKRDVNHDVVLKFADEINKNGFPNSQMEIDDLWEICYGSQTVDIRRFPDMKDMVGKLKAKGFRVTLWTHPFINKGCEPWYSEAKAKGYLVSSEYGSVETSWWNDNGTTTSYIDFTKPDARQWYVDRLRALQKSNGIDSFKFDGGESSWSPQIPVLRGDIRDQPGVITADYVRAVAEFGPMVEVRAGYRTQDLPVFVRMIDKDSYWTFENGLPTVVTTLLQMNMNGYPLVLPDMIGGNGYNEPPTKELFIRWLQATTFMPSMQFSYVPWDFDNETIEISQKYVALHAKHAVDIVAACKQATLDGTPVNPPIWWIAPNDTTAYDIWDEYLLGEGILVAPVLERGARSRDVYLPPGTWLAQGDPGRVFPGGDWIRKYPAPLDTLPYFIRA

Summary

Similarity
Belongs to the glycosyl hydrolase 31 family.
EMBL
BABH01031586    KZ150013    PZC75030.1    NWSH01001097    PCG72625.1    ODYU01001088    + More
SOQ36836.1    RSAL01000164    RVE45336.1    AGBW02009556    OWR50519.1    PZC75029.1    KQ458981    KPJ04460.1    BABH01031610    BABH01031611    OWR50521.1    PCG72627.1    RVE45338.1    LADJ01009642    KPJ20937.1    PZC75027.1    OWR50520.1    RVE45337.1    PZC75028.1    GANO01003733    JAB56138.1    PCG72626.1    GFDF01005272    JAV08812.1    GFDF01005271    JAV08813.1    GFDL01004729    JAV30316.1    GFDF01005301    JAV08783.1    GFDF01005277    JAV08807.1    GAKP01007549    JAC51403.1    GAMC01013151    JAB93404.1    DS232644    EDS44382.1    GDHF01029666    JAI22648.1    CH477301    EAT44243.1    GDHF01025510    JAI26804.1    GECU01028408    JAS79298.1    GEBQ01008596    JAT31381.1    HQ015443    ADL40394.1    JXUM01114446    KQ565787    KXJ70664.1    GECZ01007254    JAS62515.1    PYGN01002153    PSN31308.1    KJ576837    AIA09350.1    JTDY01003042    KOB70265.1    DQ515931    ABF71570.1    AJVK01030572    AJVK01030573    AJVK01030574    ATLV01020585    KE525303    KFB45426.1    AXCM01014517    JRES01001582    KNC21726.1    APCN01002678    APCN01002679    CH933806    EDW15828.1    CVRI01000058    CRL02784.1    UFQS01000448    UFQT01000448    SSX04071.1    SSX24436.1    GEZM01063873    JAV68942.1    CH940650    EDW66712.1    AXCN02001904    UFQS01000118    UFQT01000118    SSW99999.1    SSX20379.1    AAAB01008978    EAA43680.4    LBMM01005028    KMQ91888.1    UFQT01000758    SSX27019.1    KA646719    AFP61348.1    GL448504    EFN84538.1    CH964272    EDW84817.1    KK853055    KDR11965.1    KK107459    EZA50367.1    QOIP01000004    RLU24248.1    CH916369    EDV93512.1    GEDC01025706    JAS11592.1    KQ979433    KYN21584.1    GANO01003734    JAB56137.1    CM000364    EDX14422.1    CH902617    EDV42621.1    AXCM01009062    ATLV01020576    ATLV01020577    ATLV01020578    KFB45418.1    EAA13629.5    KQ981673    KYN38385.1    LADJ01000497    KPJ20835.1    AXCN02000286    APCN01002681    APCN01002682    GFDL01006647    JAV28398.1   
Pfam
PF01055   Glyco_hydro_31        + More
PF12416   DUF3668
Interpro
IPR000322   Glyco_hydro_31        + More
IPR013780   Glyco_hydro_b       
IPR017853   Glycoside_hydrolase_SF       
IPR035892   C2_domain_sf       
IPR022136   DUF3668       
SUPFAM
SSF51445   SSF51445       
Gene 3D
PDB
6JR7     E-value=4.16265e-24,     Score=278

Ontologies

Topology

SignalP
Position:   1 - 18,         Likelihood:  0.988878
 
 
Length:
638
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
10.36773
Exp number, first 60 AAs:
10.36528
Total prob of N-in:
0.51995
POSSIBLE N-term signal
sequence
outside
1  -  638
 
 

Population Genetic Test Statistics

Pi
18.674189
Theta
18.907618
Tajima's D
-1.31254
CLR
0.721438
CSRT
0.0854957252137393
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号