SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12757
Annotation
PREDICTED:_uncharacterized_protein_LOC105841331_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.235 PlasmaMembrane   Reliability : 1.374
 

Sequence

CDS
ATGTATCATTTTAATCGCGTTTGTTTTGGTCTACGGTGCTCGCCGTACCTTGCTATGAAGACAGTTAAGCGTCTCGCCCGCGATGAAACTGATTTCCCGATCGCTTCAGAAATCGCTAGTGATCATCTTTATATGGATGATCTAGGAGTTTCGGTAGATACGCCCGAGAATGGAATTCAGTTGGCTCATGATTTAATCGAACTATTCAAACGTGGTGGTTTCGACTTAGTTAAATTCGTTAGCAACTCGCCCGAGGTGTTAAAATCGATTCCGCAAGCCAACCGCTTATCTTCAAAAATTGAATTCGATAAGGAGGATAATATGAAGCTCCTAGGTTTAATCTGGTCACCGGTCGAGGATGAATTTTCAATCGCTATTAAATTCAACCCGCAAGCAAAATGTACTAAACGCCTTATGCTTTCCACAATCGCTAAACTGTGGGACATAAACGGATTTTGTGCCCCTGTCATCTTACACGCAAAATTATTAATAAAAGCTCTTTGGATAGCTCAGATTGATTGGGATGTAGAGCCCCCAAGCGACATCTGTGCTGCATGGAAACGCTTTCTTAGTGAACTCCCCGCTCTGCAAGACTTTAAAATACCTCGCTTCGTAGGCATCGTGCCCGAGTCCCGTGTCATACTACTGGGATTTGCGGACGCTTCTGAAAAAGCGATGGGTGCTTCTGTGTACATTTGTGTACAACCGGCTTCCGGACCAAATGAAGTCAATTTAATTGGTGCCAAGAGCAAGGTCGCGCCGCTCAAGGTTGTTACATTAGCCCGCTTAGAGCTTTGTGCTGTAGTATTATTATCGAAGCTGTTTCGATTTGTTATCGACACTGTTTCTCCCCGCTGTCATGTCGACGAAATTTTCGCGTTTACTGATTCGACAGTGACCCTCCATTGGGTTCACTCGTCTCCACATCGCTTTGATACTTTCATTGCGAACCGCATCGCACAAATACAGAACAACCTTGACCCCAAACACTTCTACCATTGTGAAGGTACGCAGAATCCCAGCGACTGCTTGAGTCGTGGTCTCACACCCGCTCAATTATTGAATCACCCGCTGTGGCTCCATGGCCCCACATGGGCTCGTGATGACGTCCATACATGGCCCATCAACCGCTTCACGTTTGATCCCGCACAAGATGAAAAGATATTAGAGCTCAAAAAACAATCAAATGTCTTCATCACTACAGATGAGACAGAACCCTTTCTCTGTACGCTGGCCAAGCGCGTCTCTTCTTGGTCTAAGCTGCTCCGCATTGTGGTGTATATATATCGTTTCTTGGGTAAGCTCCCTCGCTCGGACCGAATGCAACTTGCACATCTACAGTTTGCTGAGACTGCTGTCAAAACTCACCGCCTTTACAATGGCCAATGGGCATAA
Protein
MYHFNRVCFGLRCSPYLAMKTVKRLARDETDFPIASEIASDHLYMDDLGVSVDTPENGIQLAHDLIELFKRGGFDLVKFVSNSPEVLKSIPQANRLSSKIEFDKEDNMKLLGLIWSPVEDEFSIAIKFNPQAKCTKRLMLSTIAKLWDINGFCAPVILHAKLLIKALWIAQIDWDVEPPSDICAAWKRFLSELPALQDFKIPRFVGIVPESRVILLGFADASEKAMGASVYICVQPASGPNEVNLIGAKSKVAPLKVVTLARLELCAVVLLSKLFRFVIDTVSPRCHVDEIFAFTDSTVTLHWVHSSPHRFDTFIANRIAQIQNNLDPKHFYHCEGTQNPSDCLSRGLTPAQLLNHPLWLHGPTWARDDVHTWPINRFTFDPAQDEKILELKKQSNVFITTDETEPFLCTLAKRVSSWSKLLRIVVYIYRFLGKLPRSDRMQLAHLQFAETAVKTHRLYNGQWA

Summary

Similarity
Belongs to the synaptobrevin family.
EMBL
GAIX01013989    JAA78571.1    GEZM01054789    JAV73399.1    GBHO01044644    JAF98959.1    + More
GBHO01044645    JAF98958.1    GBHO01044643    JAF98960.1    GBBI01004276    JAC14436.1    GALX01004947    JAB63519.1    GBHO01027393    JAG16211.1    GDHC01006469    JAQ12160.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01028569    JAT11408.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    APCN01002077    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GDHC01014057    JAQ04572.1    LBMM01007770    KMQ89434.1    GEZM01085145    GEZM01085143    JAV60187.1    GEBQ01005223    JAT34754.1    GECZ01006169    JAS63600.1    GEZM01054766    GEZM01054765    JAV73410.1    LBMM01012238    KMQ86334.1    JAV73413.1    LBMM01009496    KMQ88090.1    GALX01000776    JAB67690.1    GBHO01020799    JAG22805.1    GEBQ01018232    JAT21745.1    RSAL01000392    RVE41994.1    LBMM01005079    KMQ91831.1    DS497760    EFA13221.1    GAMC01009674    JAB96881.1    LBMM01009688    KMQ87939.1    ABLF02005684    ABLF02066034    LBMM01012188    KMQ86362.1    LBMM01011492    KMQ86800.1    LBMM01009403    KMQ88162.1    GECZ01008071    JAS61698.1    KQ971357    EFA07702.1    GAMC01021577    GAMC01021573    JAB84982.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LBMM01010405    KMQ87487.1    LBMM01024307    KMQ82592.1    LBMM01009442    KMQ88136.1    GGMR01005823    MBY18442.1    GBHO01009080    JAG34524.1    GBHO01044316    JAF99287.1    LBMM01009551    KMQ88039.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01009964    KMQ87756.1    GBYB01000873    JAG70640.1    LBMM01011283    KMQ86917.1    LBMM01009863    KMQ87831.1    GBHO01029149    JAG14455.1    ABLF02006985    GBBI01004211    JAC14501.1    GBHO01020765    GBHO01014531    JAG22839.1    JAG29073.1    GBHO01038800    JAG04804.1    LBMM01011245    KMQ86943.1    GGMR01002421    MBY15040.1    LBMM01011244    KMQ86944.1    JYDQ01000499    KRY07301.1    GGMS01010524    MBY79727.1    ABLF02017056    LBMM01016286    KMQ84479.1    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    LBMM01016285    KMQ84480.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF00078   RVT_1
PF05585   DUF1758
PF03564   DUF1759
PF16528   Exo84_C
PF13774   Longin
PF02945   Endonuclease_7
Interpro
IPR041588   Integrase_H2C2        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR021109   Peptidase_aspartic_dom_sf       
IPR032403   Exo84_C       
IPR016159   Cullin_repeat-like_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR011012   Longin-like_dom_sf       
IPR010908   Longin_dom       
IPR000727   T_SNARE_dom       
IPR001969   Aspartic_peptidase_AS       
IPR038563   Endonuclease_7_sf       
IPR004211   Endonuclease_7       
SUPFAM
SSF53098   SSF53098        + More
SSF74788   SSF74788       
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF64356   SSF64356       
Gene 3D

Ontologies

Topology

Length:
464
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.16466
Exp number, first 60 AAs:
0.00052
Total prob of N-in:
0.00923
outside
1  -  464
 
 

Population Genetic Test Statistics

Pi
1.174488
Theta
3.572295
Tajima's D
-1.463402
CLR
12.773078
CSRT
0.0578471076446178
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号