SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12755
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 1.77
 

Sequence

CDS
ATGGTCAGGAACGACAGACTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGACTTGACGCGTTAGTTGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCGTCAGGATACCGCTGAAGCCATAGACATCTTAACGGAACTCCTTAGAGCTAAGAACGCCTCAATACGCGCCTACGACAGGTATCCTACCGCGGGAAATCGTATTCGAATGCGTGCCCTACAACGCAACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGACAAAGCAGAGTTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATGTCTAACCGCGATATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLSLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSRQDTAEAIDILTELLRAKNASIRAYDRYPTAGNRIRMRALQRNVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDDKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRVSLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGMSNRDIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGAPPHGAHSCGA

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ973412    EFA12510.2    KQ971729    KYB24751.1    ABLF02022418    KK115285    KFM64681.1    GBBI01004395    JAC14317.1    GEBQ01004157    JAT35820.1    GGMS01006359    MBY75562.1    GGMR01004661    MBY17280.1    KK118005    KFM71947.1    GALX01005299    JAB63167.1    ABLF02008153    ABLF02008462    ABLF02008464    KK113281    KFM59799.1    GGMR01018716    MBY31335.1    ABLF02065839    ACPB03027378    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01015412    MBY28031.1    GGMR01016297    MBY28916.1    GFTR01008279    JAW08147.1    ABLF02007779    ABLF02007782    ABLF02050375    GGMR01002322    MBY14941.1    GALX01005359    JAB63107.1    GFTR01008262    JAW08164.1    NWSH01007753    PCG62823.1    ABLF02034467    NEVH01006736    PNF36716.1    KK119261    KFM75202.1    GFTR01008261    JAW08165.1    GGMR01013409    MBY26028.1    ABLF02042518    ABLF02057746    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    GGMR01000226    MBY12845.1    GFXV01000908    MBW12713.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    ABLF02037715    ABLF02042385    ABLF02037436    ABLF02024246    GFTR01008256    JAW08170.1    KK119069    KFM74603.1    NEVH01011985    PNF31054.1    NEVH01005277    PNF39135.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGFK01009732    MBW43053.1    GGFK01009846    MBW43167.1    NEVH01005923    PNF38085.1    NEVH01023280    PNF18085.1    ABLF02028535    ABLF02028545    GEZM01053022    JAV74219.1    ABLF02012584    ABLF02013765    ABLF02024884    ABLF02023911    ABLF02017874    ABLF02027031    ABLF02023551    ABLF02023561    ABLF02041767    GFTR01008251    JAW08175.1    GBGD01000415    JAC88474.1    GGMR01012189    MBY24808.1    ABLF02040174    ABLF02040183    ABLF02055266    NEVH01021205    PNF19912.1    GGMS01006655    MBY75858.1    GEZM01021881    JAV88842.1    GEZM01084970    JAV60359.1    GFTR01008271    JAW08155.1    GGMS01016818    MBY86021.1    GEZM01084969    JAV60363.1    NNAY01003095    OXU19992.1    MCIT02004487    PHT96476.1    APGK01002019    KB734578    ENN83542.1    RSAL01000708    RVE41206.1    ABLF02006577    ABLF02015943    ABLF02049076    ABLF02052356    NEVH01016302    PNF25823.1    GDHC01018248    JAQ00381.1    GGMR01006581    MBY19200.1    M22874    M38643    KK119692    KFM76444.1    GGMR01006408    MBY19027.1    NEVH01001347    PNF42966.1    GGMR01016905    MBY29524.1    ABLF02003241    ABLF02003242    ABLF02025904    GGMS01002786    MBY71989.1    GFTR01008257    JAW08169.1    GGMR01012676    MBY25295.1    GFTR01008151    JAW08275.1    NEVH01002556    PNF42024.1    GFTR01008038    JAW08388.1    LBMM01015125    KMQ84919.1    M17214    AAA28508.1    M38437   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF14291   DUF4371
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR025398   DUF4371       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
434
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
14.30697
Exp number, first 60 AAs:
0.05318
Total prob of N-in:
0.11027
outside
1  -  434
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
25.211895
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号