SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12754  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA007197
Annotation
PREDICTED:_uncharacterized_family_31_glucosidase_KIAA1161-like_[Papilio_polytes]
Location in the cell
Extracellular   Reliability : 1.311
 

Sequence

CDS
ATGGCTGCACTCAGGATAATCTTAGCGCTGATGTCGCTGGGGGCACGAGCTCACTCGGCCAGCGTCTCCATATCCTCACCACGAGCCGACGACGTAATCCTGACTTTGGAGCCGCAGCTAACTGGAGGATTCAGTGTTGTGCTCATCGATAGTAACGATGCAGACAGAACAGTTTTCAGTCACATCGGCCGTACCATCGTCTCGAGTTCCACGTACACTGTGGAAGATATCGAGGGAGGAGTTCAGATCAACGTAGGCGACGTCAATCTGACTGTTCACACCTTATTCGATGATGCCTCTGGTGCTAGAGGCATTAAGTTTAAGTGGAACGCCACTCCGCAGACAAGACTCGAAGACTGCATTGATTTTGGATCGAAGCACTGGTACGCCGGTCCCATGCAAGTGGACCAAATATATCCCGTACAACTGGCCGAGCAGCGTTATTCCGCGTCGATTATCAAAGAAAACGACAACGGTGCAATCGCTGAACGATACTGGCTCAATTCTGCCGGAGAATACGTTTACGTGCACCCTGATGTACCACTGTTCGTTGACTATCACAACCTTTCACCTAATCACCTCTGTTTTGGAGCCCAAATCGCCGAGCCGTATTCCTCTAGGAGAACGCACACTGTACTTGCCTATGACGTGTGGTTTCTTTCAAACGTAAAGAAGGCACATAAACATGCAGTGGCCAACTATTTGGGCCAACCCTCTGGCCTGCCAGACTTCAGGATGGTTCAGCATCCGATTTGGTCGACTTGGGCACAGTACTCCCAAGATATTGACGCAAAGAAGTCACTAGACTTTGCAAAGCAAATCAAAGACAACGGTTTCCAGAACTCTCAATTTGAAATCGATGATTTGTGGGAAATTTGTTACGGTTCTTTAACGATCGATGAGGAGAAATTCCCGAATTTCACGAAAACGGTTCAGGATATAAAGGCGCTGGGATATCGAGTCACTATTTGGGTACATCCTTTCATCAACAAAGGCTGCGAACCGTGGTACTCAGAAGCTTTGAACAATGGATATTTGGTGCTAAACGAAGCAGGAAGCGCAGACGGCTCGTGGTGGAACAACAACGGAACTCTGGCAGGGTTCGTGGACTTCACCAACCCCGCTGCCGCCGAATGGTACTACCAGCGCATCAGCACTCTCATTAAAACCTACGACATTGACAGCTTGAAGTTTGACGGAGGCGAATCCAGTTTTACACCACAGATAGCGGTTCAGACCGGAGACATCGACCTCCAGCCTCATCTCATCGTTGAGGCGTACGCCAGAACCTGCGCGAGGTTCGGTAGCATGGTCGAAGTCAGAGCGGGCTTCAGAACCCAAGACCTCCCGATCTTCGTTCGCATGGTAGACCGCGACTCCATCTGGGGCCTCAACAACGGCCTCTCCACAATTGTCACGACCACCATTCAGATGAACCTGAACGGCTACACGCTGGTGCTCCCCGACATGATCGGCGGGAACGGCTTCAACTTGAACCACGACCAGGCCGACCTGCCCACTAAGGAACTCTTCATCAGATGGGTCCAGGCTAACACGTTCCTGCCTGCGATGCAGTATTCATTCGTGCCTTGGAATTTCGATAACGAGGTGAGCTCTTTTTAA
Protein
MAALRIILALMSLGARAHSASVSISSPRADDVILTLEPQLTGGFSVVLIDSNDADRTVFSHIGRTIVSSSTYTVEDIEGGVQINVGDVNLTVHTLFDDASGARGIKFKWNATPQTRLEDCIDFGSKHWYAGPMQVDQIYPVQLAEQRYSASIIKENDNGAIAERYWLNSAGEYVYVHPDVPLFVDYHNLSPNHLCFGAQIAEPYSSRRTHTVLAYDVWFLSNVKKAHKHAVANYLGQPSGLPDFRMVQHPIWSTWAQYSQDIDAKKSLDFAKQIKDNGFQNSQFEIDDLWEICYGSLTIDEEKFPNFTKTVQDIKALGYRVTIWVHPFINKGCEPWYSEALNNGYLVLNEAGSADGSWWNNNGTLAGFVDFTNPAAAEWYYQRISTLIKTYDIDSLKFDGGESSFTPQIAVQTGDIDLQPHLIVEAYARTCARFGSMVEVRAGFRTQDLPIFVRMVDRDSIWGLNNGLSTIVTTTIQMNLNGYTLVLPDMIGGNGFNLNHDQADLPTKELFIRWVQANTFLPAMQYSFVPWNFDNEVSSF

Summary

Similarity
Belongs to the glycosyl hydrolase 31 family.
EMBL
BABH01031581    BABH01031582    BABH01031583    KZ150013    PZC75028.1    AGBW02009556    + More
OWR50520.1    LADJ01000497    KPJ20835.1    ODYU01001088    SOQ36836.1    RSAL01000164    RVE45337.1    NWSH01001097    PCG72626.1    KQ460882    KPJ11463.1    JTDY01003042    KOB70265.1    KQ458981    KPJ04460.1    OWR50521.1    LADJ01009642    KPJ20937.1    BABH01031610    BABH01031611    DQ515931    ABF71570.1    RVE45338.1    PCG72627.1    PZC75027.1    PZC75030.1    BABH01031586    PCG72625.1    RVE45336.1    PZC75029.1    OWR50519.1    GANO01003733    JAB56138.1    CH964272    EDW84817.1    GEZM01063873    JAV68942.1    GFDF01005271    JAV08813.1    GFDF01005277    JAV08807.1    GFDF01005272    JAV08812.1    GFDF01005301    JAV08783.1    GAKP01007549    JAC51403.1    GDHF01017116    JAI35198.1    HQ015443    ADL40394.1    GDHF01029666    JAI22648.1    GDHF01025510    JAI26804.1    CH477301    EAT44243.1    KJ576837    AIA09350.1    GEBQ01008596    JAT31381.1    CH940650    EDW66712.1    GECU01028408    JAS79298.1    JRES01001582    KNC21726.1    GEZM01006957    JAV95530.1    KA646719    AFP61348.1    CH902617    EDV42621.1    GAMC01013151    JAB93404.1    CH933806    EDW15828.1    CH916369    EDV93512.1    KK853055    KDR11965.1    CP012526    ALC45294.1    CM000364    EDX14422.1    PYGN01002153    PSN31308.1    AXCN02001904    JXUM01114446    KQ565787    KXJ70664.1    UFQS01000118    UFQT01000118    SSW99999.1    SSX20379.1    UFQS01000448    UFQT01000448    SSX04071.1    SSX24436.1    AAAB01008978    EAA43680.4    GECZ01007254    JAS62515.1    LBMM01005028    KMQ91888.1    AXCM01014517    DS232644    EDS44382.1    AE014297    BT023924    AAF56462.1    ABB36428.1    GFDL01004729    JAV30316.1    ATLV01020585    KE525303    KFB45426.1    AJVK01030572    AJVK01030573    AJVK01030574    KC776580    AHH86056.1    QOIP01000004    RLU24248.1    EDW83817.1    OUUW01000008    SPP83989.1    SPP83988.1    CM000160    EDW98754.1    CM000070    EAL29004.2    MH365884    QBB01693.1    KC776579    AHH86055.1    GU462153    ADC97876.1    CVRI01000058    CRL02784.1    JXUM01070718    KQ562623    KXJ75464.1    KK107459    EZA50367.1    CH479185    EDW38284.1    KC776576    AHH86052.1    CH954182    EDV53672.1    GEDC01025706    JAS11592.1    APCN01002678    APCN01002679    KC776578    AHH86054.1   
Pfam
PF01055   Glyco_hydro_31        + More
PF12416   DUF3668
Interpro
IPR017853   Glycoside_hydrolase_SF        + More
IPR000322   Glyco_hydro_31       
IPR013780   Glyco_hydro_b       
IPR035892   C2_domain_sf       
IPR022136   DUF3668       
SUPFAM
SSF51445   SSF51445       
Gene 3D
PDB
2F2H     E-value=1.55423e-07,     Score=134

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.963219
 
 
Length:
540
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05758
Exp number, first 60 AAs:
0.0132
Total prob of N-in:
0.00123
outside
1  -  540
 
 

Population Genetic Test Statistics

Pi
20.207557
Theta
15.680224
Tajima's D
-0.712508
CLR
3.289619
CSRT
0.1976401179941
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 LEDCIDFGSK 100.00 5e-08
28556443 AYPAPLDVLPYFVR 100.00 5e-08
28556443 VLEGPTWLR 100.00 2e-06
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号