SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12745
Annotation
integrase_core_domain_protein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.372
 

Sequence

CDS
ATGAAAAATGCCAAATCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAAAAGGAATATCCCCATAGGGAAGCACTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTAGAAAACTCCACTAGAGAAGACGTCACAAAAGTCAAGAAAATATTCAAATATTTAGTGGGAACCAAAGAGAAAGGCATTTTGTTCAAACGAAATAAACCGATAGAGAATATCGATAGTTACAGAGACTCGGATGATGCTGGAGATCCAAAACGCAAAGAAGCACTTCTGGCTCCGTGCTAA
Protein
MKNAKSCDTPASSDSKSIQETAQEKEYPHREALGSLLYLSTRTRPDIAQAVNLVSRKVENSTREDVTKVKKIFKYLVGTKEKGILFKRNKPIENIDSYRDSDDAGDPKRKEALLAPC

Summary

EMBL
GBHO01013072    JAG30532.1    GBHO01005715    JAG37889.1    GBHO01003079    JAG40525.1    + More
GBHO01040574    JAG03030.1    GBHO01040573    JAG03031.1    LBMM01009639    KMQ87973.1    MJFZ01000952    RAW24002.1    GBHO01037840    JAG05764.1    LBMM01012772    KMQ86003.1    GBHO01031779    JAG11825.1    NCKW01017192    POM59370.1    GECZ01009601    JAS60168.1    KL367687    KFD60198.1    GECZ01017843    JAS51926.1    GBHO01016409    JAG27195.1    GECZ01000150    JAS69619.1    GDHC01004875    JAQ13754.1    GEZM01099971    JAV53080.1    GDHC01010945    JAQ07684.1    GALX01006157    JAB62309.1    DS567555    QLLG01000626    QKXF01000006    RMX62449.1    RQM18873.1    LBMM01027002    KMQ82250.1    DS567745    DS567497    DS566001    DS566383    GEBQ01029584    JAT10393.1    GEZM01078128    GEZM01078127    JAV63002.1    MJFZ01000618    RAW26780.1    GBHO01041007    JAG02597.1    GDHC01009233    JAQ09396.1    DS567087    LBMM01020254    KMQ83327.1    DS568207    LBMM01012672    KMQ86060.1    DS567139    DS566289    KI913645    ETV63694.1    DS568535    GECL01003258    JAP02866.1    DS568262    NCKW01003798    POM75488.1    DS566231    DS567564    AB378753    BAG68376.1    GEZM01093140    JAV56327.1    DS566082    LBMM01011114    KMQ87021.1    KL367655    KFD60665.1    ABLF02066511    LWTN01000174    ORU94050.1    DS566242    DS566098    BABH01033959    BABH01033960    KQ483738    KYP42039.1    DS567717    GBHO01019280    GBHO01019277    GBHO01019272    GBHO01014987    JAG24324.1    JAG24327.1    JAG24332.1    JAG28617.1    DS568300    KQ971338    KYB28117.1    DS566148    DS566071    NCKW01000038    POM81641.1    DS567770    KN538522    KHJ39825.1    KL367684    KFD60227.1    GEZM01090252    JAV57314.1    KQ483414    KYP53356.1    DS566011    AAZX01006115    AAZX01021021    DS568418    CM003604    KYP72919.1    OIVN01002268    SPD02134.1    KQ483498    KYP48513.1    LYXU01000014    OBS17533.1    CM002870    KFK41513.1    DS567227    ABLF02066512    JXUM01122536    KQ566615    KXJ69965.1    GEZM01048830    JAV76370.1    DS566328    DS568148    NCKW01020291    POM58281.1    OIVN01002376    SPD03107.1    NCKW01004050    POM75106.1    GEZM01002084    JAV97376.1    GBHO01028636    GBHO01028635    JAG14968.1    JAG14969.1    DS566528   
Pfam
PF07727   RVT_2        + More
PF13976   gag_pre-integrs
PF00665   rve
PF00098   zf-CCHC
Interpro
IPR039537   Retrotran_Ty1/copia-like        + More
IPR013103   RVT_2       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
117
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.50726
inside
1  -  117
 
 

Population Genetic Test Statistics

Pi
3.122597
Theta
11.764491
Tajima's D
-2.038829
CLR
0
CSRT
0.0104494775261237
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号