SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12740
Annotation
hypothetical_protein_M514_07281_[Trichuris_suis]
Location in the cell
Nuclear   Reliability : 3.25
 

Sequence

CDS
ATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAACACCGATGACTCTTAAAGAAATACTGGATAAACATTCACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGTTAGATCGTCTGATCTCAGAAGGGATAGTGGAAAAAGTAGATCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAATTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCGATTTTCGATCAACTACGCCAAAATCTCGCAAACGATACAAAGAAATGCATAACGTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAGCCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAACCTCTTATACATATTATGGGTGCACGCCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTATCAGAACAGTTACTTATGAAAACAACTGCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGTATACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACACCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAATACAAATCTCGAGCGCCGACTATTAGAATTTCTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGGTTAATGCAGTATTTACAAGTAAAAGAAAATATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCTTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGACGACTGCTTCTCCAGACATTGGAATGGAAACATCAATTAGCGAAAGGCTAACTAACAATAAGAATTCATTACCTACACCGCAGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGTAATCGACGTATACAGGCACCCCGTCGTCTGATCAACGAGATGTAG
Protein
MEFPKPVYSIKTSTPMTLKEILDKHSQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIERELDRLISEGIVEKVDPNITPIEWATPTVNILKSTGEIRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANDTKKCITSSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGARRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTAKDHILTKVCQNLKTGWRESVYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLPTTASPDIGMETSISERLTNNKNSLPTPQSPTNVQISPNSPSQHSKLYSSPAPVSTPVPFAPRRSNRRIQAPRRLINEM

Summary

EMBL
GBHO01042589    JAG01015.1    GBHO01042596    JAG01008.1    KL367712    KFD59941.1    + More
GDHC01014693    GDHC01004534    JAQ03936.1    JAQ14095.1    KL367659    KFD60588.1    GFTR01008725    JAW07701.1    KL363234    KFD51952.1    JWZT01000439    KII74358.1    JYDL01000067    KRX18868.1    JWZT01002984    KII68048.1    EF199622    ABM90393.1    GBHO01045651    GBHO01045644    GBHO01026684    GBHO01026679    JAF97952.1    JAF97959.1    JAG16920.1    JAG16925.1    AERX01052799    AERX01052800    GEGO01004800    JAR90604.1    JYDO01000377    KRZ65389.1    JWZT01005674    KII60352.1    JYDL01000080    KRX17894.1    EF199621    ABM90392.1    AZHX01001899    ETW98900.1    JYDK01000060    KRX78865.1    GEFM01002211    JAP73585.1    GEFM01006397    JAP69399.1    MRZV01000143    PIK57404.1    GBIH01000761    JAC93949.1    GFAA01002662    JAU00773.1    JYDN01000036    KRX62859.1    JYDI01000010    KRY59721.1    JYDW01000348    KRZ48953.1    JYDN01000181    KRX54093.1    KRX54086.1    GEBQ01020673    GEBQ01011946    JAT19304.1    JAT28031.1    JYDH01000010    KRY40903.1    GFAC01001150    JAT98038.1    HADW01008367    SBP09767.1    GEGO01004546    JAR90858.1    NIVC01000050    PAA92506.1    GEGO01004812    JAR90592.1    HADX01010638    SBP32870.1    GDHC01007869    JAQ10760.1    JYDO01000093    KRZ71620.1    AAGJ04101977    GBHO01042583    JAG01021.1    GEGO01004367    JAR91037.1    JYDI01000800    KRY43965.1    JYDP01000327    KRZ01162.1    JYDQ01000025    KRY20467.1    JYDL01000001    KRX27995.1    NIVC01001652    PAA65446.1    GBHO01027659    JAG15945.1    KRX62850.1    NIVC01000075    PAA91739.1    GEGO01004729    JAR90675.1    NIRI01001153    RJW67559.1    GACK01009588    JAA55446.1    GEGO01004533    JAR90871.1    NIVC01000551    PAA81070.1    AERX01039690    HAAD01006009    CDG72241.1    JYDI01000169    KRY49681.1    GEGO01004875    JAR90529.1    JYDJ01000764    KRX33566.1    GFWV01022123    MAA46851.1    NIVC01001006    PAA73574.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF00098   zf-CCHC
PF00077   RVP
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR041373   RT_RNaseH       
IPR034128   K02A2.6-like       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
3S3N     E-value=4.48893e-17,     Score=218

Ontologies

Topology

Length:
770
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000880000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00006
outside
1  -  770
 
 

Population Genetic Test Statistics

Pi
11.608495
Theta
17.621481
Tajima's D
-1.121762
CLR
25.430759
CSRT
0.114544272786361
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号