SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12729
Pre Gene Modal
BGIBMGA007176
Annotation
PREDICTED:_zinc_finger_protein_2_homolog_isoform_X1_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.786
 

Sequence

CDS
ATGTACAGTTTAAAGTTTTATCCATTGGAGACCTATTATGAAGATATCGTAGAAGTTAACCCCGAATGTTCTCCAGATCTACCACAGTGTGTATGTTATCTTTGTGCAGGATTATTGAAAAAGTATAGCAGATTTAAAAGTAAATGCTTAGTTGCACAATCCTTATTTTATAAAATACTAAAGTCTGGTAAAAAGGTCAATATTGAATCAGTAAAATCATTAGATAAACACTATTTGAAAAAATCATTGACTATTTATACTGAAACGGATGTCACACCAACAGACTTATTCCACAACGATTCTCCTACAGAATATTTGGACATTCCAGCTGATGATAATATTATTATAGAAAATGAAGACTCATTAGAAATAAATGAAACAAATTCAGAAGACTATTGCAATATTGAATACCTAAGCGATGAAGATTATAGTGACTTACAATCTCAGTTGGATTCTAAAGAACTATCGTTGGTACATTTACAAGAAGAAATTAATACCAATAGTAATCTGAGCGAAAATGACATCAAAATTGAGGCTGTATCGAGTAGAGAATTCCAATTTGTTGATACAATCGATGATATATCGTCATCACCATCAGAGAAAATTGGAGTTAAACAACCGAAGCGGATTAGTAAATCTAATATTTCTAAAACAGATTCTGAATATCCTATGGAAAAAATTAGAAGGACCACACTTGAAGTATCAGAAGATGAAATTAATCTAAACGAATGTTGTACCATACAGATTTTAAGCAAAGAAAAGCAGTTAGAAGAGATAATGAAACGGAAATATTCTAAAAACTACAAAAACTCTCCGCACAAGTGTCAGCTCTGCTACAAAGGTTTCTTGAACAACGATGCTTGGAACCATCACTTGTCCAAACATTCATCTAGCGCGGGCAGCTTGCAGTGCCCGGTGTGCAAGCTCCGGTTCAAGACCAGACAGAACCTGTACCGCCACGGGATCAACCACGAGAGGAAGTACATCTGTAAGCGGTGCAACCACGTCGCCACCACGGCTAATCAAGCGAAGATGCACCAGAGATGGCACAGAGGGATCACGTACACGTGTCACCTCTGCGGCGAAGTGTCCACGAAGTACACGTCACACCTGAGTCACGTGCGCATCAAGCACCCGTCGCAGTTCGTGTGCGGCGCGTGCGGCTCTTCCTTCGTGAGCCGCCTGGGTCTGGCCATGCACCGCGCCGTCATGCACAAGCACCGCCCCGAGGCGGCGGAAGGCGGGCCGTACTGCGCGGAGTGCGACCTGCGGTTCGCGTCGCGTGCCGCCTACTCCAAGCACCTGCTCACGTCCGTCAGGCACGTCGATGACGTCAACAACAAGTGCCGCATCTGCGACGGGTCCTTCGAGTCGAGCCAAGCGCTGCAGGACCACGTGGCGCAGTGCCGCCGCGGGCTCCCCGAGAGGCCGGCGCCGCGGCCGCGGGGGGGCCGCCCCGCCCCCGCCCCGGACCAGAGCTGGCCGATTATATGTGAACAGTGTCCGGAGCAGGTGGGCAGCGCGCGCGACTACTGGAACCACTTCCGGCGCGCGCACCCCGACCAGCCCTACCCCGCGCAGAGCAATCACGTGTGCGACGTGTGCGGCCGCGGGTTCAGGCGTAAGTCGATGTTGGTCTACCACAAGTGGAGTCACTCTGACGAACCCAAGTTCAAGTGTGAGACGTGCGGCAAGGCGTTCCAGCATCCCAACGGACTCTATTTCCACCGGAGATGGCACACCGACCTAAGGCCGTTCTCCTGTCCCGTCTGTCCCAAGGCCTTCCTGGACAAGTTTGGGCTCGAGAGGCATTTGAGGTGTCACACAGGGGAGAAGCCGTACCGCTGCCAGCTGTGCGACCGGGCGTTCAGCCAGTCCAACAGCCTCAAGGGACACATCCAGAGCGTCCACTTGAAGAAGCCCTACCCCAAGCGCGCGCGCAGGCGCCGCCCCCGCCCCGACCCCCGCGCCCCCGCCTCGCCCCCCGCCTCGCCCCCCGCCGCGACCAACAAAAAACGGCTCAGTCGATGA
Protein
MYSLKFYPLETYYEDIVEVNPECSPDLPQCVCYLCAGLLKKYSRFKSKCLVAQSLFYKILKSGKKVNIESVKSLDKHYLKKSLTIYTETDVTPTDLFHNDSPTEYLDIPADDNIIIENEDSLEINETNSEDYCNIEYLSDEDYSDLQSQLDSKELSLVHLQEEINTNSNLSENDIKIEAVSSREFQFVDTIDDISSSPSEKIGVKQPKRISKSNISKTDSEYPMEKIRRTTLEVSEDEINLNECCTIQILSKEKQLEEIMKRKYSKNYKNSPHKCQLCYKGFLNNDAWNHHLSKHSSSAGSLQCPVCKLRFKTRQNLYRHGINHERKYICKRCNHVATTANQAKMHQRWHRGITYTCHLCGEVSTKYTSHLSHVRIKHPSQFVCGACGSSFVSRLGLAMHRAVMHKHRPEAAEGGPYCAECDLRFASRAAYSKHLLTSVRHVDDVNNKCRICDGSFESSQALQDHVAQCRRGLPERPAPRPRGGRPAPAPDQSWPIICEQCPEQVGSARDYWNHFRRAHPDQPYPAQSNHVCDVCGRGFRRKSMLVYHKWSHSDEPKFKCETCGKAFQHPNGLYFHRRWHTDLRPFSCPVCPKAFLDKFGLERHLRCHTGEKPYRCQLCDRAFSQSNSLKGHIQSVHLKKPYPKRARRRRPRPDPRAPASPPASPPAATNKKRLSR

Summary

Pfam
PF00096   zf-C2H2        + More
PF07776   zf-AD
PF05485   THAP
Interpro
IPR013087   Znf_C2H2_type        + More
IPR036236   Znf_C2H2_sf       
IPR012934   Znf_AD       
IPR038441   THAP_Znf_sf       
IPR006612   THAP_Znf       
SUPFAM
SSF57667   SSF57667       
Gene 3D
PDB
5V3M     E-value=3.06468e-24,     Score=279

Ontologies

Topology

Length:
676
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0085
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00013
outside
1  -  676
 
 

Population Genetic Test Statistics

Pi
18.07317
Theta
17.608949
Tajima's D
0.254262
CLR
0.622317
CSRT
0.449127543622819
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号