SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12725
Pre Gene Modal
BGIBMGA007178
Annotation
PREDICTED:_uncharacterized_protein_LOC106652727?_partial_[Trichogramma_pretiosum]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 2.305
 

Sequence

CDS
ATGACGGATCCGATGATCAAGGTAAAGACGGAGAGGCCTGACGAGGCCGAAATCCGGGAGTTAGCTGCTAAAATGGTGGAGGCGAACAAAGCGAAAGCTCTGGCGGCATCGGTGGCAGCGACGCGTACACCACCTGGAGGTCTAGTGCCACCAGCTTCCGGCCAAATGGGCATCCTAAATTTTTTGACAAGGAAACCTGGAGCGACTGGCACAACAATAGACCAACGACCTGCTCCAGATCCTGAAAAGAAAACCCCTGCTCCAGACGAAGCTAGTTGGAAGGGGCACTTTGGATGGGATGTTCTTGGCAAATGCCACATACCTTATATTTTTCGGTCCAACGAAAAGTATGTGGCAGTCCGGATGGTGGAAATCAAGCTCCTCAACAAGTACCTGAATTACCTCCATGCTGACATCTACTCCTGTACCTGTATCAGAAGTTACTATATTACTGAGATAGAGGCTCGTTTACTCAATGAGATAAGCAACAGGCATTGTGATGGACAGTTTGGCCGGGAAGCATTCACACAGAAAGACTTAGTTGTGAGGTTGTCAGACGCATATGAGTTTTATAATTTCTTAGATGTGTGTTATTATAAACTATTGAGGGGAACAACGAATAGCAAGGACAAGTGTGGTTTTATAAGGATAAACAAGGAGTCTGTTGTACCATACACAGTGCGAGACAATCAAAAGTTTGTGCCGTTATTTTATTTTGAAGGTGAAACGGAGAATTTAAAGTTAAAAGCAGATCAGCTGAAAGGCTGGGACTTGTCGTATTTGAAGTTCTGTTGTAAAGTGCAGGGCATTAGGAACGAACTTTTTGCAAGTGAGACATGTTCTGTGATAAGTTTGAATGATATTAAGAGTTATTTTCCACCGGGAACTGAGTTTGAAGAGTATTGGCCCAATAAAGTGGTAGACTCCCAGCTCCTCATATCAGCGAAAGGATCAGTATCGGGTGGAGGACAATGGACGAGAGCACCGCCTGCGCCTCCCCCGGTGGTGGGTGGTGTGGCAGTGGGTTCGGCGGCCGGCCTCAACACCGTCAACAGCCAGTCGACACGAGGCCGCCGGGCCAACACACAGAGGCACACTCCTACCGCTGCCACCATGCAGATGTCCCACGCCGGACTATCGGCTGCCTCCGCTCAAGCGCTCGCCAACAGCTGGTCTCTGCCCGGAACTCTTACTCAGGCGCAAACGCAGCAAGTGCTCAGGTTTGCTCAGGCTCAAGTGGTGGCGCAGGCGGCCGCCCGGTACAACACGGCTGCCATCGCAGCGGCCGCCGGATTTCCACATAAATCGCAGCACCAGAGAAACGTTCAGTTTCCGAACAGTGCACTAACAATGGCGATGGGTCAGCAACCCCCTCCACCTCTTGTGAGGAGCACGGCCAACACAACAACTATGAAAGCCAGTATCTTAAAAGGCAATATTCCCTTTTTAGCTACGTATAATGGTTTTAAATATCCACAAAGACCAGTGGATTTGCCGGAATTGGATATTATTGCTGAGAGACTTATTTCACCAAGGCTTCCGTTTATGCAAATACGTAGATTACGCCATTTCAATGGTCAATTTGCTATAACTGGCCAAATAATTAATGTGCCTGTCTCGGTTGATAATATGATAAAACTTTTACCAAGGCCGCTTGATGGAAATGAAGAAGACTATTGTATTAATGTTCATATTAAGAAGAAACTTATTCATAAAACAAGTTACCTTCACGGATTGGTTAAAGGTATTGTCATTAAAAAATGGTTGACGTATTTAATTGAAACACCTCTGTATAAGCACTTCCAAATTAAAGTGGATGATGCTTGGTTTACATCCAATGGTGAGAAAGTCATAATTGATTACACGGATACAGGAGGATCGAGTAGACAAGATGATGTGCAAGAGCTTCCATCCTCTGAAACAGCAAATCACACTCACTCTGTGGATTCTGACTCCATAGAAAAACGAATACACATCGATGATTTAAGTGAACATATTGTGATTGATGAAAGTCTGACTGCGCAACAGCAAACTCTCATGTGGAGTGAGGATAAATTTTTACAAATTGCTCCAGGTGAAAATAAAGTTCCAGAGAGTTTGTTATTTGACACATATGCAGAGGAATTATCATTTCCAGCCATTTACCTTGGGGAATTTCGTGTATTTCGAGAAGAAGCCAATGTAACGCCATTCATGATGGCAACAAGTGAATTACGTCGTTCAGACAGGAGAGGAGTACTTCCTAATAAGCTTCTTTACACGGCAATGAAAATAATGCGCTTAAGAGTTTGCAGTGCTCTGAAGATTGGATTCAAACACATCGGTAAGGATACCAATATAAGTAAAGAACGCGTATTATCTGATGATTACATAAATGCCTGTTTGGAAACAAATTTAGCTTTTATGAAGTCAATCCCTAATTCTGCAACTTATTGGTCTGCGCGAAAGCGAGATCTTTTTGCAATGATGCGCCAGTTGGGTAGGCCAACTATGTTTTTGACCATAAGCGCGAATGAAATTGGATGGCCAAACCTTCTAAGGATTTTACACAAATTGAAAAATCAGGGAGAAGAGTTAACCGATGAGCAAATTGAAGTGTTGAATTATTTTCAAAAGACAACTCTGATTAATGATGATGCCGTCACCTGCGCAATATATTTCAATAAATTGATTAATGTAATCATGCTTATATTGCAGTCAAAGAAGTTGAGTCCATTTGGTAAATATCGAGTGAGTCATTATTTCAAGCGGATTGAATTTCAACATAGAGGTAGCCCACACGCCCATATACTATTATGGTTAGATAATTCACCAAAAGATGCATTGGGGAACGACTACGAAGAAGCGATTGCATTAATTAATTCGCTTATTTCAGTGGATTCATCTGAAGCTTCCGGTCACATCAAACTTCAAACTCATAAACACACCTTCACGTGTTATAAAAACACTCGTACAAATAATCGGCAATGTCGTTTTGAAGCACCTTTTATGCCTATTCGCCAAACTACTATTCTCATCCCGCTAGACAAGGAGAATCCAGAGTTACAAAGACTTAAATCGCGGTATAAAAATATACGACAAAACTTAGAAAGTAATGACTACGAAAATATTGAACATTTTTATCAAGACAATTGCATAATATCAGATGATGACTACGTTAACATTTTACGAGCTGGGATAACTCGGCCTCGAGTATTTTTAAAACGGAGACCTTCAGAAAAATGGCATAATTGTTTTAATCCTTTTATTTTGAACGTGGTTGGGTCTAATATGGACTTCCAATTTATCACCGAAGAATATTCATGTGCTCAGTACGTTGTCGACTACATAAATAAGACTAACAGAGGAATCAGTAACTTACAACAAAAACTCGTCGAAATTATGAATGATAATCCTGACTTCGACATTATTGCTGCTACAAAGAAACTTAGCGTCAACGCGCTGAATACAATTGAAATGTCAAGCCAGGAAGCAGCGTGGTTTCTTTTGCGTGAACCCATGTCTAAAGCGTCAGTAGCTATTGAATATATTCCAACATACTGGCCACAACAGCGAGAAAGAATTCGAAAAACATTAAAAGAATTAGCGCAACTTGAAGATGATGATACAAATGTATGGAAGGAAAATTGGTTCGACAAGTACGAGAAAAGACCTGCTATAATTAATGATATCACTCTAGCTCAGTTTGTTTCGCGATATACTGTCAATGCTGCCGGAAATGTTAAAGAACGAAAAGTCCCAAAAGTTATAAGATTCCGAAATTATGATATGGGGAAAGAGTTAACAGAATACAAGAGGGAAATGGTTACGCTACATATGCCTTTCAGAATTGAAGAAACTGATGTTTTGAGTGATATGAAGTTTTTGCGCATCTATGATGAAAATGAAGATCTCATAATGGAGAGACGAAAAGAATTTGAATCTAATTTAGATATCGCAAAAACAATGGAAATTTGTGCACAATTATGTCGGGAAGAGACGGAGCTCAACGATGTGCAGGCAAATAACGATGACCAGAACAGGGCTAATGTCCAAGAAATTCTAGATCCATACCAACAGTTTCTTCAAGATCCAAACTCGGTTATTAACGATGATTTAGTATCAGCTTCAATGAATAAACTCGGAGCGATATGGAAAAAAAAAGACAACCTCATGGAGACTCCAGAGTTTCTTGAGCTCATGAGAAGAACTAACGAGAAGCAATTCGAGCTGGCTCAACACATAATATGGTTATTGACTTCAAAAAACCCAATGCCGTTACAACTATTTTTGACTGGTCCTGCTGGATGTGGGAAAACTTTTCTCATCAGACTGATTATGGAAATTTGTAATAGATTCACAGATACAGATGGCTACTGCAATGCTTATCTTGTATGTGCATCCACTGGAAAAGCTGCGGTTGCTATTGGAGGTACAACTGTTCACACCGCTTTCAAAATTACTCTATCCAGTTTTCAAATACCTTTATCTAACGAAGTCAAGGGCTTGTACAGATGTTTATTCAAGTATGTAAAGATGATACTTATTGATGAAGTCAGTATGATAGGAGCAGAAATGTTAGAACGTATAGATTTGAGGTTGAAAGAAATAACCGGAAATTATGATACCTCTTTCGGTGGATTACATATTATTTTTATTGGTGATTTGAGACAATTGCCTCCAGTTAGAGCCACACCAATTTGGAAACAAAAAATTCAACGGATTGATGGTCAGCAGTTATGGAGAGGAATTAGTTTTTACGAGTTGACAGAAGTTATGCGCCAAGAAAATGCTCAATTTTCTTCATTATTGACAAAAATTGAAGGGGAAGCGGAGCAACGTTGTCCTGGAGGAATTCGATTATTTAATGACAACCATTCAGTTGATGCGTACAACTTGAAAGTGTTGAGTTCATCTGATGAAATATCAAATTCAGTTGCTGATGATGAATTTTTGGGGTGTGAAAATGATCGCGAAAAGCAAAGAGTTGCTAGAGAAAAGTTGTACAAACTTAGTACAATTGACACGGGAGGATTACCTTATGAAATTATTTTTGCTCCAGATAAACCCTACATGATAACGACCAATATTGATGTTGCTGACGGATTAGCCAATGGAGCGGTAGGCAAATTGATCCATGTTGAATTAGGTGTTGATGATAGAATTTTAAGAGTTTGGCTTCATTTTCCTAACGGCGTCGGTGTTAAAGCTCGAGCAAAAACAGCTGGATATGCGAATTCAAAAGGAATTGATAATACAGCGGTTCCTATCAATCGTAGAACTGCAACAATTCCTCTCAACCGGAACAAATCAATTCATGTCAAAAGAAATCATTTTCCGTTAAAACCAGCTTGCTCCTTAACCATTCATAAATCTCAAGGTGGAACTTTTGATGAAATAGTTTACAAGTACAGCAAAGCTCACTCACAGTCTTTAGTTTACGTAGCTTTATCTAGGGTTACGAGTCAACAAGGACTTTACATTGTATCTAGTGAAGATCAACGTTTTCACCATGGCAGACGTGAAAATCAAGCGATGCTTTTCGTGCCTCCGCAAGTGACCGGCACGATGAATGGCCACTCAACCTCTCACTCCGTGGACACTCGCAAAAGGCTTACACCGATACCAGACATCAACACTACTGGCAACCATACGCCGTATAAGGTACAAAAGGCGTTAGTGGAAAACACAATGGTGCCTTGCATCAATTCGAAGCCCTACCAGTACACGGAGCTGCTGATGACCCTGCCGGACCTCGCCAGCCACTTCTTCCCGCGCGTCTCGCTCACCACCTGCCGCGCCATGCTCGACGCGCTCGGACTCATTCTCTACCGGCCTAACTCAACCCAACTTCAAGTTCTGCGCAACTCTGGCAAGTGCAAGTCGGCGGCCGCCGGCGAGAACGGGATGGCGTTGGTTCAGGTCCGTGACGTCATGCATCACATGCTGCAGTTCAAGTACATGCTGCGCTCCGGGCTCGGGGACGACCCGGCCGCCCACCCGCCCCCCGCGCACCTGCACCCCCACGCCAAGCGCGCCAGGGCCAACTGA
Protein
MTDPMIKVKTERPDEAEIRELAAKMVEANKAKALAASVAATRTPPGGLVPPASGQMGILNFLTRKPGATGTTIDQRPAPDPEKKTPAPDEASWKGHFGWDVLGKCHIPYIFRSNEKYVAVRMVEIKLLNKYLNYLHADIYSCTCIRSYYITEIEARLLNEISNRHCDGQFGREAFTQKDLVVRLSDAYEFYNFLDVCYYKLLRGTTNSKDKCGFIRINKESVVPYTVRDNQKFVPLFYFEGETENLKLKADQLKGWDLSYLKFCCKVQGIRNELFASETCSVISLNDIKSYFPPGTEFEEYWPNKVVDSQLLISAKGSVSGGGQWTRAPPAPPPVVGGVAVGSAAGLNTVNSQSTRGRRANTQRHTPTAATMQMSHAGLSAASAQALANSWSLPGTLTQAQTQQVLRFAQAQVVAQAAARYNTAAIAAAAGFPHKSQHQRNVQFPNSALTMAMGQQPPPPLVRSTANTTTMKASILKGNIPFLATYNGFKYPQRPVDLPELDIIAERLISPRLPFMQIRRLRHFNGQFAITGQIINVPVSVDNMIKLLPRPLDGNEEDYCINVHIKKKLIHKTSYLHGLVKGIVIKKWLTYLIETPLYKHFQIKVDDAWFTSNGEKVIIDYTDTGGSSRQDDVQELPSSETANHTHSVDSDSIEKRIHIDDLSEHIVIDESLTAQQQTLMWSEDKFLQIAPGENKVPESLLFDTYAEELSFPAIYLGEFRVFREEANVTPFMMATSELRRSDRRGVLPNKLLYTAMKIMRLRVCSALKIGFKHIGKDTNISKERVLSDDYINACLETNLAFMKSIPNSATYWSARKRDLFAMMRQLGRPTMFLTISANEIGWPNLLRILHKLKNQGEELTDEQIEVLNYFQKTTLINDDAVTCAIYFNKLINVIMLILQSKKLSPFGKYRVSHYFKRIEFQHRGSPHAHILLWLDNSPKDALGNDYEEAIALINSLISVDSSEASGHIKLQTHKHTFTCYKNTRTNNRQCRFEAPFMPIRQTTILIPLDKENPELQRLKSRYKNIRQNLESNDYENIEHFYQDNCIISDDDYVNILRAGITRPRVFLKRRPSEKWHNCFNPFILNVVGSNMDFQFITEEYSCAQYVVDYINKTNRGISNLQQKLVEIMNDNPDFDIIAATKKLSVNALNTIEMSSQEAAWFLLREPMSKASVAIEYIPTYWPQQRERIRKTLKELAQLEDDDTNVWKENWFDKYEKRPAIINDITLAQFVSRYTVNAAGNVKERKVPKVIRFRNYDMGKELTEYKREMVTLHMPFRIEETDVLSDMKFLRIYDENEDLIMERRKEFESNLDIAKTMEICAQLCREETELNDVQANNDDQNRANVQEILDPYQQFLQDPNSVINDDLVSASMNKLGAIWKKKDNLMETPEFLELMRRTNEKQFELAQHIIWLLTSKNPMPLQLFLTGPAGCGKTFLIRLIMEICNRFTDTDGYCNAYLVCASTGKAAVAIGGTTVHTAFKITLSSFQIPLSNEVKGLYRCLFKYVKMILIDEVSMIGAEMLERIDLRLKEITGNYDTSFGGLHIIFIGDLRQLPPVRATPIWKQKIQRIDGQQLWRGISFYELTEVMRQENAQFSSLLTKIEGEAEQRCPGGIRLFNDNHSVDAYNLKVLSSSDEISNSVADDEFLGCENDREKQRVAREKLYKLSTIDTGGLPYEIIFAPDKPYMITTNIDVADGLANGAVGKLIHVELGVDDRILRVWLHFPNGVGVKARAKTAGYANSKGIDNTAVPINRRTATIPLNRNKSIHVKRNHFPLKPACSLTIHKSQGGTFDEIVYKYSKAHSQSLVYVALSRVTSQQGLYIVSSEDQRFHHGRRENQAMLFVPPQVTGTMNGHSTSHSVDTRKRLTPIPDINTTGNHTPYKVQKALVENTMVPCINSKPYQYTELLMTLPDLASHFFPRVSLTTCRAMLDALGLILYRPNSTQLQVLRNSGKCKSAAAGENGMALVQVRDVMHHMLQFKYMLRSGLGDDPAAHPPPAHLHPHAKRARAN

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
Pfam
PF14214   Helitron_like_N        + More
PF05970   PIF1
PF02689   Herpes_Helicase
PF04843   Herpes_teg_N
PF13538   UvrD_C_2
PF02801   Ketoacyl-synt_C
PF00443   UCH
PF08659   KR
PF14765   PS-DH
PF00109   ketoacyl-synt
PF16197   KAsynt_C_assoc
PF00107   ADH_zinc_N
PF00698   Acyl_transf_1
PF02902   Peptidase_C48
PF14529   Exo_endo_phos_2
Interpro
IPR010285   DNA_helicase_pif1-like        + More
IPR025476   Helitron_helicase-like       
IPR027417   P-loop_NTPase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR003840   DNA_helicase       
IPR000014   PAS       
IPR035965   PAS-like_dom_sf       
IPR038765   Papain-like_cys_pep_sf       
IPR006928   Herpes_teg_USP       
IPR003653   Peptidase_C48_C       
IPR027785   UvrD-like_helicase_C       
IPR016039   Thiolase-like       
IPR001394   Peptidase_C19_UCH       
IPR014030   Ketoacyl_synth_N       
IPR020843   PKS_ER       
IPR013968   PKS_KR       
IPR002364   Quin_OxRdtase/zeta-crystal_CS       
IPR020801   PKS_acyl_transferase       
IPR029063   SAM-dependent_MTases       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR001227   Ac_transferase_dom_sf       
IPR020807   PKS_dehydratase       
IPR036736   ACP-like_sf       
IPR014031   Ketoacyl_synth_C       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR028889   USP_dom       
IPR013149   ADH_C       
IPR032821   KAsynt_C_assoc       
IPR011032   GroES-like_sf       
IPR042104   PKS_dehydratase_sf       
IPR014043   Acyl_transferase       
IPR036291   NAD(P)-bd_dom_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR003593   AAA+_ATPase       
SUPFAM
SSF52540   SSF52540        + More
SSF56219   SSF56219       
SSF55785   SSF55785       
SSF54001   SSF54001       
SSF50129   SSF50129       
SSF53335   SSF53335       
SSF47336   SSF47336       
SSF53901   SSF53901       
SSF52151   SSF52151       
SSF51735   SSF51735       
PDB
5FTF     E-value=2.68464e-22,     Score=267

Ontologies

Topology

Length:
2009
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.766729999999997
Exp number, first 60 AAs:
0.02662
Total prob of N-in:
0.00305
outside
1  -  2009
 
 

Population Genetic Test Statistics

Pi
2.054805
Theta
26.217929
Tajima's D
-1.403523
CLR
124.181699
CSRT
0.0745462726863657
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号