SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12715
Pre Gene Modal
BGIBMGA013095
Annotation
reverse_transcriptase_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.154
 

Sequence

CDS
ATGGCTCAACTTATAGGAAACATATCTGAGTTTGATTATAAAACCCAAGAATGGCAGATCTTTTACAAGAAATTAGAAAATTTCCTAAAGTTGAACAAAGTTTTAGCTGAAGATTGGTGCTCCGTGCTTATTGCACATCTTTCAGATGATTCGTATCGGCTTGTGAGGAACCTCGTACATCCTAACGAGGTAGAAACAATACAATGGACTGAGCTGGTTAGAGTACTCAACGGACATTTTCAACCGAAAAGATCGACTTTTGCCGACAGGGCAAAATTTTATGGTGCGATCAGAATGGACGGTGAGAAAGTCGAAGATTGGGCGGCACGTCTGAGGGGACTCGCCGTGCACTGTAATTTCGGTACAGAATTAGATACGTTGCTACGTGATCGATTTATTCTAGGCCTGAAGGTAGGTCCAGAAAGAAATCGATTGTTCGAACAAGACTCGAACTCCCTAACGCTTTCAAGAGCTATTGAAATAGCCCAGGAGACTGCGTGTGCGCGGGCGGCGAGAGCTGATGTTGATGGTGGTGAGCAGCTTATCAAACAAGAGGTGGTGTATCGTGTCAGCGAGCGTCGGGCGCGGGGCGCCTCGACGCAGGCGGAGTCGTCGTGGGCATCGGCGGCAGCCGCGCGCTGTGCAGTGTGCGGGTTGAAAGGTCATTCCGTAGAAAAGTGCCGTTTCAAAGACTATAAGTGTATGATTTGTGGTAAAAAGGGTCACCTTAAGAAAGTGTGCAGTGTCAAAAAGGTCGGAAAACTGTCGTTAAATAATATGGATGATAACGAAAGCGATGGACACGAATGTAAAAAATGTGATTTGTATAATTTAAGGTATGTTCGCTACGATCCTATTAAGTTGAACATTTCTATAAATAATAAGTTTTATTCTATGGAATTAGATTGCGGAGCTGCTCGTAGTGTAATTTCAGAAAGATTTTACAGGGATAACTTCCCATTATACAAATTAAGCGCATCACCTGCAAGTATGATGTTTGGACGTAATTTAAGAACAAGATTAGATTTAATATTACCCACTAAAAAAGTGGAAGATAATGCAGTTGTTCCTAATAAAGAAATAAGTAAATCTAGACAATTCCAAATAGGTGAAATAGTCTGGGCAAGATTTTTTATTGCTCGAAAGGCTAGCTGGATGAAAGGAAAAATAACGAATATCTTAGGCAATAGAATGTTTCAGATCAATTTTGAAAACTGTGATTCAACGTGTGTCAGACATTTGGATCAGATTAGGAAGTACACGGATGCTAGGTCAAAAACAATTGTGAGCGATGTTGTTTCCACCGAAGGCGCTAATATTTCAGTCCCGGATCGACCCACAACAATGCAATCAGTATCGCAGCCTAGCTCTGAGATAGTGCTGTCCTCACCTATGTCGTCGCCGCCGGTACCGGAGCCGGCACCAGTATCGGCCCCCACGCACGGCAATAACGTTGACATTGTGAGGGGGGAGGATGAGGAGGGCGATGAATGGGAGGAGGCTAGTGAAAACATCGCAGCTGCCAGCCTGCCGACCGAGTGTGAACCTGATTACCCTATTGTAGCATCAGATGACCCCGATAACGTGAGATTAGAAGAGAGGGCGCCAGATAATGAAAGACAGTGTGGTCGACCAAAGAGGACAAGAAAAGTAGTAGATTATAAGAAGTATTTTTAA
Protein
MAQLIGNISEFDYKTQEWQIFYKKLENFLKLNKVLAEDWCSVLIAHLSDDSYRLVRNLVHPNEVETIQWTELVRVLNGHFQPKRSTFADRAKFYGAIRMDGEKVEDWAARLRGLAVHCNFGTELDTLLRDRFILGLKVGPERNRLFEQDSNSLTLSRAIEIAQETACARAARADVDGGEQLIKQEVVYRVSERRARGASTQAESSWASAAAARCAVCGLKGHSVEKCRFKDYKCMICGKKGHLKKVCSVKKVGKLSLNNMDDNESDGHECKKCDLYNLRYVRYDPIKLNISINNKFYSMELDCGAARSVISERFYRDNFPLYKLSASPASMMFGRNLRTRLDLILPTKKVEDNAVVPNKEISKSRQFQIGEIVWARFFIARKASWMKGKITNILGNRMFQINFENCDSTCVRHLDQIRKYTDARSKTIVSDVVSTEGANISVPDRPTTMQSVSQPSSEIVLSSPMSSPPVPEPAPVSAPTHGNNVDIVRGEDEEGDEWEEASENIAAASLPTECEPDYPIVASDDPDNVRLEERAPDNERQCGRPKRTRKVVDYKKYF

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
558
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000720000000000001
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00091
outside
1  -  558
 
 

Population Genetic Test Statistics

Pi
2.12112
Theta
21.232345
Tajima's D
-1.482704
CLR
45.875779
CSRT
0.0598470076496175
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号