SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12701
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Sodium/hydrogen exchanger      
Location in the cell
Mitochondrial   Reliability : 2.185 Nuclear   Reliability : 1.536
 

Sequence

CDS
ATGCAACGGCCCCCAGTACCCGGCAGCTCTACTATTCCTGGCCACGGTGGCGGTCACGGTAACGGTAGGGCAGGGGGTGCGAAGAATCCCCGGTCGGCAGGCCACCATAAACAACTGACCATTGGCACGTTTAACACCCGGACTTTGAGGCGAGATGAGGATGTGGAAGAGCTGGAAGTAGAATTGAGGTCCATTAAATGGCATATCCTTGGGCTTTCGGAGGTCCGTAGAGAGGGTGAGGACACCGTCATCCTCGAGTCTGGAAACCTCTTCTACTACCGTAAAGGAGACCAGCTCTCTCAAGGCGGTGTTGGGTTCATCGTTCACAAAGCCATCGCTAACAACGTCTTGGAGCTATCGAGTGTGTCGTCGCGGGTGGTGTACATTATAGTTAAAATCTCAGAGAGATATTTACTCAAGGTCGTGCAAGTGTATGCACCAACGGCGACACACCCTGATTGTGAGGTTGAGGCCTTATATGAAGACATCTTTAAGGCCATTCATAACACCACCAAGACCCACTTCACCGTTGTAGTTGGCGACTTCAACGCCAAAGTGGGAATACAAGGGGAAGACGAATCCATAATTGGACGGTATGGTTTGGGGACGAGAAACCACAGAGGACAAATGCTTGTTAATTTTCTGCAGATGGAGGGACTCTATTTGATGAACTCGTTTTTCAAAAAGAAGCCCCAAAGGAGATGGACTTGGCAAAGTGCCGACAAAGTGACACGGAACGAGATCGATTTCATCATGGCGGATAAGAAGCGAATATTTACGGATGTCTCAGTGGTCAACAGGTTTAGTGCCGGTAGTGACCACCGACTTATTCGAGGAACCCTAAATATCGACATAAGGCTTGAAAGAACCCGGTTGATGAGATCGACTCTGCGCCCGTCTCTTCCCCAAATCATCCAAGTTTCCGAGAAGTTCCAATTGGAACTTCAAAATCGATTCAGTCTGCTGGATCCCACTGAGGACGTGAACGACGTGGTGGAGAACATGGCGGCGACACTACGTGAAGTTGGCGGAAGATACTTTGGATCACAGCGGAGAGTTCGTGAAGCCAAGCTAACCCCTGAGACTCTGGCATTAATGAGGAAACGACGAGAAGCCACTCCATCCACAAGAGCTACAGCAGAGTACGCAACCTTAAATAAGGACGTCCGGAGGATGGTGAGGCGTGACTACCGTAACTTTAATGCTAAACGCATTGAAGCTGCGATAGAGCGCAATAAAGGCCTTAAAGCCCTTGTACGGACGTCTAAAAGTGCTCCTCTGCTTAAGCTTAAGCGAGAAGATGGTTCTATAGTTACTTCCAAGCCAGAAATCTTAGGCGAGGTCGAAAAATATTATGGCAAACTCTACGCAATGCACACTTCTCTACCTACACCCGCCAACCGAGCTAGTGACAGCCGAGCACCGCTTACTCGGCATTACTCGGATGATGTCCCGGACATCAGCATCGGGGAGATTCGGATGGCCCTGGAACAGCTCAAAAATGGTAGAGCGCCTGGTGAAGATGGAATTACTACGGAGCTGCTGAAATCCGGAGGGGTTCCTATCCTGAAGGAATTACGGAGCCTGTACAATTCCGTCATACACAATGGGAATACACCATTGGCGTGGACAAGGAGTCGGGTCATGTTGTTCTTCAAGAAAGGTGATAAAACTTTGTTGAAGAACTATAGACCGATATCTCTTTTGAGCCACGTCTACAAGGTCTTTTCTAGGGTCATTACTAATCGTCTCGCCCGAAGGCTTGATGAATGCCAGCCACCGGAGCAGGCTGGGTTTCGAAAGGGTTACAATACCGTAGACCATATTCACACCCTCAGACAGATTATAGAAAAGTCTACAGAATATAATCTGCCACTTTGCGTGGCTTTCGTGGACTACGAGAAAGCCTTTGACTCTATCGAGACCTGGTCAGTTCTGGAATCCTTACAGCGATGCCAGATAGACTATCGCTATATCGAGGTGTTGAAAAGTCTATACGAAGCCGCGACGATGACCGTACAAATCCAGGATTGCCAGTCTAGACCTATCAAGCTGCAGCGGGGTGTCCGACAGGGAGATATTACATCTCCGAAACTGTTCACCGCTGCACTTGAAGATGTCTTCAAGACGCTGGACTGGAAAACATGTGGAATCAACGTCAACGGAGAGTACATGTCACACCTTCGATTTGTCGATGACATAGTCTTAATGTCGGAATCGCTGGAGGACCTCAGTCGTATGCTCAACGATCTCAATGCTGCTTCCCGATGCGTGGGACTGCGGATGAACCTTGACAAGACGAAAGTCATGTTCAATGATAAAATCGTCCCGGGCCAAGTTACCATCTCGAATGCAGTCATTGAAGAGGTAAAAGACTTTGTCTACCTCGGTCAGGCTATCCAGCTTGGCCGGGGTAACTTCAATACAGAGATTGAGAAACGCATACGACTGGGTTGGTCGGCATTTGGGAAATTCCGTGCAATCCTCACCTCGCAAATTCCTCAATGCCTGAAGACAAAAGTCTTTAACCAGTGCATTCTCCCCGCTATGACCTACGGCGCGGAAACCTGGACACTGACGGCAGGGCTGGCCCATAAGTTAAGAGTCGCACAGCGGGCGATGGAGAGAGCTATGCTAGGTATTTCTCTAAGGGACAAAATCCGGAACGAAGAAATTCGACAGAGAACCAAAGTCGACGACATAGCTCTCAAAGCTAGCAGGCTGAAGTGGCAATGGGCCGGACACATCATTTCAATCAATCAAGTCAGCGGTAGTACAGGAAACCGAAACCGGTTTAGTGGTGCTTAA
Protein
MQRPPVPGSSTIPGHGGGHGNGRAGGAKNPRSAGHHKQLTIGTFNTRTLRRDEDVEELEVELRSIKWHILGLSEVRREGEDTVILESGNLFYYRKGDQLSQGGVGFIVHKAIANNVLELSSVSSRVVYIIVKISERYLLKVVQVYAPTATHPDCEVEALYEDIFKAIHNTTKTHFTVVVGDFNAKVGIQGEDESIIGRYGLGTRNHRGQMLVNFLQMEGLYLMNSFFKKKPQRRWTWQSADKVTRNEIDFIMADKKRIFTDVSVVNRFSAGSDHRLIRGTLNIDIRLERTRLMRSTLRPSLPQIIQVSEKFQLELQNRFSLLDPTEDVNDVVENMAATLREVGGRYFGSQRRVREAKLTPETLALMRKRREATPSTRATAEYATLNKDVRRMVRRDYRNFNAKRIEAAIERNKGLKALVRTSKSAPLLKLKREDGSIVTSKPEILGEVEKYYGKLYAMHTSLPTPANRASDSRAPLTRHYSDDVPDISIGEIRMALEQLKNGRAPGEDGITTELLKSGGVPILKELRSLYNSVIHNGNTPLAWTRSRVMLFFKKGDKTLLKNYRPISLLSHVYKVFSRVITNRLARRLDECQPPEQAGFRKGYNTVDHIHTLRQIIEKSTEYNLPLCVAFVDYEKAFDSIETWSVLESLQRCQIDYRYIEVLKSLYEAATMTVQIQDCQSRPIKLQRGVRQGDITSPKLFTAALEDVFKTLDWKTCGINVNGEYMSHLRFVDDIVLMSESLEDLSRMLNDLNAASRCVGLRMNLDKTKVMFNDKIVPGQVTISNAVIEEVKDFVYLGQAIQLGRGNFNTEIEKRIRLGWSAFGKFRAILTSQIPQCLKTKVFNQCILPAMTYGAETWTLTAGLAHKLRVAQRAMERAMLGISLRDKIRNEEIRQRTKVDDIALKASRLKWQWAGHIISINQVSGSTGNRNRFSGA

Summary

Similarity
Belongs to the integrin beta chain family.
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Integrin beta
EMBL
FJ265545    ADI61813.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    + More
FJ265551    ADI61819.1    FJ265549    ADI61817.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    RSAL01000057    RVE49824.1    RSAL01000220    RVE44071.1    RSAL01001818    RVE40675.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    JARK01001655    EYB84321.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    FJ265561    ADI61829.1    JARK01000173    EYC41342.1    JARK01001354    EYC21986.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    GBBI01004876    JAC13836.1    FJ265564    ADI61832.1    FJ265562    ADI61830.1    EYC21713.1    FJ265563    ADI61831.1    JARK01001351    EYC23458.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    GBBI01004877    JAC13835.1    GDKW01001596    JAI54999.1    JARK01000460    EYC36749.1    JARK01001621    EYB86109.1    JARK01001626    EYB85833.1    JARK01001340    EYC30828.1    JARK01001505    EYB94618.1    JARK01001395    EYC09730.1    EYC09729.1    JARK01001389    EYC11015.1    JARK01001348    EYC25048.1    JARK01001473    EYB97806.1    EYC25050.1    EYB94617.1    JARK01001438    EYC02111.1    JARK01001459    EYB99276.1    EYB99275.1    DS268591    EFO92565.1    JARK01000343    EYC38099.1    JARK01001639    EYB85201.1    EYC25046.1    JARK01001353    EYC22263.1    EYC25049.1    DS268444    EFP01729.1    QFQQ01000179    PZR20596.1    ODYU01008249    SOQ51673.1    EYC16376.1    EYB98944.1    GBGD01000380    JAC88509.1    JARK01001711    EYB81734.1    JARK01000347    EYC38051.1    EYC09726.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001531    EYB92324.1    EYC09727.1    JARK01001359    EYC20105.1    JARK01001346    EYC26445.1    JARK01001543    EYB91356.1    JARK01001730    EYB81048.1    EYC30744.1    JARK01001475    EYB97550.1    JARK01001683    EYB82909.1    JARK01001497    EYB95322.1    EYC10874.1    JARK01000063    EYC44387.1    JARK01000109    EYC42952.1    EYC33297.1    JARK01000008    EYC46079.1    JARK01001357    EYC20551.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001344    EYC28216.1    GBGD01000453    JAC88436.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00362   Integrin_beta
PF13520   AA_permease_2
PF10328   7TM_GPCR_Srx
PF00999   Na_H_Exchanger
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR020846   MFS_dom       
IPR002293   AA/rel_permease1       
IPR016186   C-type_lectin-like/link_sf       
IPR016187   CTDL_fold       
IPR001507   ZP_dom       
IPR029052   Metallo-depent_PP-like       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
IPR004835   Chitin_synth       
IPR029044   Nucleotide-diphossugar_trans       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF56436   SSF56436       
SSF53448   SSF53448       

Ontologies

Topology

Subcellular location
Membrane  
Length:
935
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05716
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  935
 
 

Population Genetic Test Statistics

Pi
6.652401
Theta
19.041412
Tajima's D
-1.690795
CLR
214.883343
CSRT
0.0356482175891205
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号