SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12648
Annotation
Retrotransposable_element_Tf2_155_kDa_protein_type_1_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.196
 

Sequence

CDS
ATGCTGATGAAGCTTACAGTAGAATCAGAATGGAGCAAATGGGAGAAAAATTTTTGTGAGACATTTGCAAACAAAGGATGGTCCTCCACTAGATATGCTCTTGCCTTTAAATATCAATCGGGATCCTTACTTGAGTATGCTTTAAAGAAGGAGAAATTATTGTTGGAAGTCAGGAAGACAGTGGATACCGGAACAATTATTGATCTCATAGCATTTGGTTTACCCAATTATGTGGCGGACAAGATTGACAGAGAAACATTACAAAGAACGGAAGACCTTTACAATGAGATAGGAAAATTGGAACATCTGGTTTCTGGAATCTATGACTCTGGATCTAATGTTTCTTTAATTAATGCAAGATTATTGAAAATACAAGAGAAACAGAAGACAAATGATATGCAAGTTGTAAACTTAAAAACTATTAATGGTGAGAAAAAAACGAAAGGTATGGTGACGCTAAAAATAAAAATCTACAATATTGAAAGAAATATGGATATTTTTGTGGTGGATAATGAAAATTTTAACTATGACTTCTTAATTGGTTTGGATTGTATAAAAAAATTCAAATTAATACAAAATGAAGAACTTAACATCATACAATATCCCGAAAAGAAAAGCATAATCTCAAATGAACATTGTTCTAATGAGAATAATGTAACAAATGTCGGAATTCCTGATGTACTAGGTGACAAAAATAAAGAACAAACATTTAAAGAGAGAATAGAAGAGAAAGAGAAGATAGAGATGGAACTATACTCTGAGATAGTAAAAAAGGGTACTACTATAAATACCAACAAATTGTGTGAAATTAATTTCAATGAACATGTAAACATTGATGAATTTCAAATGTCTGTAAATCATCTAGATTTATATCAGCAATCAAAAATTGAGAAGTTAGTAGATAAATACAAATCTGTTTTTGCTAAGGACAAATATGATGTTGGCTCTGTGCAGGATTATGAAGCCCATATAGACTTGATGGTAGATAAATACTGCTATAAGCGTCCGTACAGATGCACAATTGAAGACAGAACAGAAATTGAAAGTCAAATATCGAAGCTACTACAGAAAAATTTGATAGAGGAATCTTACAGCCCGTTTGCTGCTCCTGTAACTCTAGCATATAAGAAAGAAGATGATAAAAAAACAAGATTATGCATAGATTTCAGAGATTTAAACAAAATAGTAGTTCCACAATCACAACCTTTCCCACTTATAGAGGACTTAATGACCAAAACAGTAAACTGTAAGTATTATTCTACATTAGATATAAACTCAGCATTTTGGTCGATCCCATTGAAAATTCAAGATAGACATAAGACTGCTTTTGTGACACAAGAAGGACATTTTCAATGGACTTGTCTCCCATTTGGGTTAAAGACTGCACCAGCGATTTTCCAAAGAATATTGAGCAATATTATAAGAAAACACAGACTATCTAACTTTGCAGTAAACTTTATTGACGACATCTTAATTTTTTCTAAAACTTTTGAGGAACATATACAACACATATCGAGACTACTGGAAGCAATACAAAAGGAAGGGTTTAGACTGAAATTTTCAAAATGTACATTTGCAAGTCACCATGCTAAATACTTGGGTCATATAATAGAAGACAATTCAGTTAGACCTCTGAAAGATTATTTAACTGCTGTCAAAAGCTTCCCAATTCCAGAAACAAGGAAAAATATACGGCAGTTTTTGGGAAAAGTAAATTTTCATCATAAGTTTGTACCACATAGTGCAATTATCCTCGATCCATTACATAACTTATTAAGGAAAGATGCGAAATTTGTATGGACGGCAGAATGCCAGGAAGCATTTGATAAAATTAGAGCATTGCTTTGCTCAGAACCAATCCTAAAAATATTTGACCCAGATTCACCGATAAGAATTTACACAGATGCTAGTATCAAAGGAGTTGGAGCAGTGTTGAAACAAGACGATGAAAACGGCGTGAGTAAACCGGTTGCTTATTTTTCGAAGAAATTAACAGAAGCACAGAAAAAGAAGAAGGCAATATACTTAGAATGTCTGGCGATAAAAGAAGCAGTCAAATACTGGCAACATTGGCTTATGGGAAAAGAATTTATGGTATACACAGATCATAAACCCCTGGAAAATATGAACATTAAAGCTCGAACTGATGAGGAACTAGGTGATTTAACATATTATCTATCACAATATAATTTTGAAATTAAATACAACCCAGGAAAATCAAATCAAAAAGCGGACTGCTTAAGCCGAAATCCAGTCCTAGAAGCAAATGATAAAAACGACGATTTTTTAAAGGTCGTAAATTTAATCGACCTACAAGAAATAAAGAATGACCAGCTAACAAATCCAGACCTACAAAAAGAAAAGAATAAGCATATATTAGAGAATGAAGTTTATTACAAGAAAAATAAAAGAAGAAATAAGATTATACTGTCAGAAAAACTTAGCAAAGCTCTAATAAAAAAAGTCCATGACACATACTGCCATATTGGAAGAACCCAGATCACAAATAAAATAACACCATTTTCAGCCAAGAATATTACAGCAAACATTAATAAAATGTGTGATGCGTGTGAAATCTGCATTAAAAACAAGTCCAGGAGGAAGTCGAAATATGGTTTAATGTCACATTTGGGACCAGCCACACACCCGTTTGAAATTGTATCCATCGATACTATTGGGGGCTTTGGAGGATCCCGATCAACCAAAAGAGAAGGGTGTAAATTGGAAGAAGGAGATAGTGTTTATATGGAGAATGGAAATAAACTAAACAGGAAGAAAATGGATGAATTGAGAACAGGGCCATACAAAATACTAAAGAAGATTTCAGAATCGATCTATGAAGTTGACACCGGACACAAAAAAGCAGAATCAAACCTCTACCATATAACAAAGTTGTCTCCAGTGTCTATCTGA
Protein
MLMKLTVESEWSKWEKNFCETFANKGWSSTRYALAFKYQSGSLLEYALKKEKLLLEVRKTVDTGTIIDLIAFGLPNYVADKIDRETLQRTEDLYNEIGKLEHLVSGIYDSGSNVSLINARLLKIQEKQKTNDMQVVNLKTINGEKKTKGMVTLKIKIYNIERNMDIFVVDNENFNYDFLIGLDCIKKFKLIQNEELNIIQYPEKKSIISNEHCSNENNVTNVGIPDVLGDKNKEQTFKERIEEKEKIEMELYSEIVKKGTTINTNKLCEINFNEHVNIDEFQMSVNHLDLYQQSKIEKLVDKYKSVFAKDKYDVGSVQDYEAHIDLMVDKYCYKRPYRCTIEDRTEIESQISKLLQKNLIEESYSPFAAPVTLAYKKEDDKKTRLCIDFRDLNKIVVPQSQPFPLIEDLMTKTVNCKYYSTLDINSAFWSIPLKIQDRHKTAFVTQEGHFQWTCLPFGLKTAPAIFQRILSNIIRKHRLSNFAVNFIDDILIFSKTFEEHIQHISRLLEAIQKEGFRLKFSKCTFASHHAKYLGHIIEDNSVRPLKDYLTAVKSFPIPETRKNIRQFLGKVNFHHKFVPHSAIILDPLHNLLRKDAKFVWTAECQEAFDKIRALLCSEPILKIFDPDSPIRIYTDASIKGVGAVLKQDDENGVSKPVAYFSKKLTEAQKKKKAIYLECLAIKEAVKYWQHWLMGKEFMVYTDHKPLENMNIKARTDEELGDLTYYLSQYNFEIKYNPGKSNQKADCLSRNPVLEANDKNDDFLKVVNLIDLQEIKNDQLTNPDLQKEKNKHILENEVYYKKNKRRNKIILSEKLSKALIKKVHDTYCHIGRTQITNKITPFSAKNITANINKMCDACEICIKNKSRRKSKYGLMSHLGPATHPFEIVSIDTIGGFGGSRSTKREGCKLEEGDSVYMENGNKLNRKKMDELRTGPYKILKKISESIYEVDTGHKKAESNLYHITKLSPVSI

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR041373   RT_RNaseH       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=4.84043e-71,     Score=684

Ontologies

Topology

Length:
970
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00759
Exp number, first 60 AAs:
0.00038
Total prob of N-in:
0.00011
outside
1  -  970
 
 

Population Genetic Test Statistics

Pi
312.36379
Theta
198.00363
Tajima's D
1.998928
CLR
21.143132
CSRT
0.88085595720214
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号