SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12639
Annotation
hypothetical_protein_RR48_06329_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.37
 

Sequence

CDS
ATGCCTTTAACTAGAAATCAAGATCGCCAGCAACGTCGCGAAGACGACGTTATTCCTGCTGCAGATGCAAATGCCAACGAAAATCACGAGGAGCATGATAGCCCCCATGATCGCCCCCACGCCGAATCACGTAGCAACAATTCTACGTTCAACCTGGATGATGTTTCAGCGTTGATGGCCTCGCTGCAACGTTCGCAGGCCGAAACATTTAAGAACATTATGTCGTACGTGATGGAACAAAGATCGTCGACTCCGGCACCTCCGCCGATGCCCCCAGTGAACGTAGATGGTACCTTGGCGCGTTGCAGAGCTTCTTTCAGCGGTGCACCTGGTGAATCTGTTGAGGCCTTTATAGATGCAATTGAAAGTTATACAGAATGCGTTCAAGTATCTGACGCTAACATCATACGAGGCCTAGCCATGCTTTTGTCTGCTGACGCAGCTACGTGGCGGCTAGGATTAAAGCATCACATCTCCACTTGGAACGAAGCCAAAGAAAATTTAATATATGCATATGGCACCCGCCTTCCACCACATAGAATATATTTGGAAATATTTGCTTCCCCGCAGGATAACGAAAACACAGACAAGTTTGTTGCTCGTATTCGTGCGCTTATGGCAAAGCTACCGCGGGATGATATTACTGAAAAAGTACAACTTGATATGATATACGGGTTGCTTCATAATAGAATACGCACAAGATTGCGCCGTGAAGAAATCACATCTTTCAATTCATTATTAAACCATGCTCGGAATATAGAAGATTCGATAGAGGAGACTCAATCGAGACCAGTGTCGTCCACTAGTGGTGTGCGTTCGATCCGTGCCCAGCCGGCCCAGGCTGCGAGTCGGCCTGAACCGTGCGCCGCTCGTGCGAGTGCCCCGGCGCCGCGCGCGCGCTTTCCAAACTCCGCCGCGGCCGTCGTGCCCGCCACCGCTGTGCCTGTCGCTGTCGCCCAGCCTGCCGCTGCCACGCCTGCCGCTGCTGTGCCAGGTTCTGCAGAGCAATTCGTGACCACGAAGAAACAGCGTCCAGTGTGCTCCTACTGCAAACGGTTTGGACATGCACGGGAACAGTGA
Protein
MPLTRNQDRQQRREDDVIPAADANANENHEEHDSPHDRPHAESRSNNSTFNLDDVSALMASLQRSQAETFKNIMSYVMEQRSSTPAPPPMPPVNVDGTLARCRASFSGAPGESVEAFIDAIESYTECVQVSDANIIRGLAMLLSADAATWRLGLKHHISTWNEAKENLIYAYGTRLPPHRIYLEIFASPQDNENTDKFVARIRALMAKLPRDDITEKVQLDMIYGLLHNRIRTRLRREEITSFNSLLNHARNIEDSIEETQSRPVSSTSGVRSIRAQPAQAASRPEPCAARASAPAPRARFPNSAAAVVPATAVPVAVAQPAAATPAAAVPGSAEQFVTTKKQRPVCSYCKRFGHAREQ

Summary

Interpro
IPR036875   Znf_CCHC_sf        + More
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
359
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.1108
Exp number, first 60 AAs:
0
Total prob of N-in:
0.05425
outside
1  -  359
 
 

Population Genetic Test Statistics

Pi
280.984647
Theta
204.225208
Tajima's D
1.391077
CLR
0
CSRT
0.763711814409279
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号