SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12638
Annotation
PREDICTED:_uncharacterized_protein_LOC106141703_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.497 Nuclear   Reliability : 2.069
 

Sequence

CDS
ATGACTGTGACACAAAAGGCAGGAAGTGTTGTAGCGTCCGTGTACGACCGTGAGAGTGATGATAGGTATTTGCATTTACGGCCTATTTTCAAAATTCAAGTTCTCGGTAAACAGGGTACTGCACTTATAGATACAGCAGCTAAGCATTGTATTGCTGGTCACACGCTGTATGCTCTCCTTCTACAAAAGGGTCACCCTCTTACTCCCTCCACTAGGCGAGTCAAACTTGCTGATGGGCATGTTCGGAATATGGATGTATTGACAACCATATTACCAGTGAGGTTAGAACACATAGTGATTGATATTCCATTTATAATCTTCCCTGATTCTAATGATAATGAAACTTTACTGGGTATTGATTTTATTAATGCTGCCAAAGTTATTATTGATTTTCCTCGTCATGAATGGTATTTTAGTACTGATGCTAAGGTGCATTATAAATTACTTTTTGAACCTATGTCTCGTGGTGTGTGCATAGCTTCTACTAACATGCTTCGGGATGATGAAGGTATGCACTTGCAATCAGCTGAGCGCCAAGCATTATCTGAGTTCCTTATTCGGCATGAAAGTATTTTTACAGCAGGGGGAGGTCCGACACCATTCATAGAACATTGCATAGACACTGGAGATCACCCCCCGATAGCTGTGCCGCCCTATCGCCTTAACCCTTCCAAGAAGGAGACGATGAAGAATGAAATAGAGAAGATGCTGGCAGATGACATCATTGAAGAGTGCGAATCCGCCTGGTGCTCTCCTGCATTGATGATACCGAAGTCCAATGGTAATGTAAGATTCTGCGTGGATTACAGGCGCTTAAATGAAGTAACCAAATCGGATACTTACCCACTCCCACGCATTGATGATCTTCTCCAGAATACAAAGAAGAATTGTTACATGACCACAATAGACCTTCGTTCTTCATATTGGCAAGTTATGGTCCGAGAAGCAGACAGAGACAAAACAGCTTTTGTCTGCCCCCTGGGCACTTACCGTTTTAAAAGAATGCCGTTCGGCTTGAAGAATGCGCCGGCGACTTTCCAAAGGCTTATTGATCGTCTACGCTCCTGTGCTGCTTTGAAGGATGTTACAGTACTTGCTTATCTAGACGATTTGTTAATTATTTCAGAAGGATTCCAGCAACACCTACAAGACCTGGAAGCTGTTTTTAGACGTTTGTCTGAATTTAAACTTCACGTAAACAGAGAGAAGTGCACTTTTGCCAAAGAAAGGGTCCGTTATCTGGGCCACGTCATCACTCCAGACGGTGTGTCTCCTGACCCTGAGAAGGTCAGTGCTGTCCTTAATATGCTGGAACCATCTAACCTAAAACATTTAAGAACTTTTCTCCAAACATGCTCTTGGTTCAGGAAGTTTATTCCAAACTTTTCAAAGATAGCAGAACCGCTTACTCGACTGACCAAGAAGAATTACACATGGATCTGGGGACCTGAACAAACACAGGCATTCAAAGAATTGAAGCGTCTGCTGACCACGGCGCCCGTACTTGTTCAAGCGAATTTTAAACAACCCTTAGTACTGCGTACCGACGCGAGCAACTATGCACTTGGCGCAGTTTTAGCTCAAGGGGAAGGCAAGGACGAAAGGCCTATCGAGTATGCTAGCCGCCTACTCACCGCAGCGGAGCGCAACTACTCTACTACAGAACGGGAAGCGCTTGCTGTAGTCTGGGCCGTGGAGCGTTTCAGGCCATACCTCGACGGCCAACCAATTATTATAGGCAGTGACCACCAACCCTTGCGTTGGTTGCTTTCTTTAAAGTCTCCTGCTGGTAGGTTGGTCCGTTGGGCGCTTAAACTCCAAGAATTTGACATTAGATTCGAGTACACCCCAGGAAAAGCTAACGTTGTCGCTGACACGTTAAGTAGACCGATCTGTTCCAACGAAACACAAAATAACTGCGGCATCTGTTCTGTCATTTGCGACCAGCCCAGCAAGTCACCTACCCAGTTACGTCAAGACCAGTTGACTGATCCGGAAATACAGAAGATCATCACAGAACTGGAAGGAGTGGATGAACTTGCTGCTAAAAGATGGTCAGAAAGAGGATTTCTAATGGAACAAGGTGTTTTATATCGACTTAATCCGGATTCTGATGCCGAGGCCCCACAATTAGTCATTCCTGCCCATCAAGTGACCGACGTTCTCAAAGAGCTTCACGATGCCCCTACCGCTGGACATGCAGGAATTGACCGGACTTACCAACAAGTCTCACGTCTGTTCTACTTCACAGGAATGAGAAGAATCATAACCGACTATGTAAAGGCATGTATCCATTGTCAACGCTATAAGGCTGCTAATACCAAGCCTCCAGGTCTATTGCAGACGCCGGTGATGAACCAGCGCAACGAGGTCTTGGCAGTTGATCTTTTCGGCCCGTTGCCACCTGGAAAACAGGGGGAGCGTTGGATCTTGCTAATAGAAGATACTGCTACGAGGTGGACAGAACTTTTCCCATTGAAGGAAGCTACTGCTGAGGCGTGTGCACATGTCCTCATAGAGGAGTATTTTATGAGATTTGGTCTTCCACGCCGACTAGTTTCTGATAATGGCGTACAATTTATTTCGGCAGTCATGCGTCAATGCATGTCCATCCTGGGGATAAAGCAAAACCTTATCCCTCTCTATCACCCAGAAGCAAACCCCGCCGAACGTAAAAACAGAGATCTTAAGACTTTATTAGCACAACTCGTGGAATGTATGTCACCTGCTTACTTGTCATTTGGCAGAGAGATGAGGTCCCCCACAGAAGTCACTCATGACCTTCGTGCTGTTCTAGACAAAGATAACTTTGTTCCCCAAATAACTCCCTATCTCAGGAAATTTGTTAACTCCTTTTCAGCGGTGCGCGAACGTGTAGAGACGCTTCAAGATAAAGCTAAAGGGTATGCTGATCGTTCGAGACGGCCCATTGAAACATTCAACGAAGGTGACATGGTTCTCATCAAATCACACGTCCTCAGTAAGAGCGCTAAAGGCCTTACTTCTAAGTTTGTTCCAAAACGCGATGGTCCGTATCGCATCGTTAAAAAGGTCAGCCCTACTACTTACCACGTCGCGCATGTTGACAAACCTGATGAAGTTTTAGGGAAATATCATGTGAACGATCTCACTCTATACCGTGAGAATCAGAGTGATGCTCTTCCGCGGCCGGTGATGCCTAAAAAGAAACGTGGTCGTCCCCCAAATAATGTTAAAACAGATTCTCGAGTTCCAGGGCATATGACGACACGGCATGCTGAACCATGTGCTGAAGCTCCACGTCTTTCTCCCGCAGCTGGTGGTATGGTTGGTCTTGCGCCTGTCCCTCAGCCCAGTAGTAATGAGATGCTAGTCCAGGAGCGAGGGCGTCCTCCAGGACTAGAGGGGGAGTATGTAGCAAACCGACCGGTACGTCACTCTCGCGGCCGTATGCCCGCTCGCTATACATAG
Protein
MTVTQKAGSVVASVYDRESDDRYLHLRPIFKIQVLGKQGTALIDTAAKHCIAGHTLYALLLQKGHPLTPSTRRVKLADGHVRNMDVLTTILPVRLEHIVIDIPFIIFPDSNDNETLLGIDFINAAKVIIDFPRHEWYFSTDAKVHYKLLFEPMSRGVCIASTNMLRDDEGMHLQSAERQALSEFLIRHESIFTAGGGPTPFIEHCIDTGDHPPIAVPPYRLNPSKKETMKNEIEKMLADDIIEECESAWCSPALMIPKSNGNVRFCVDYRRLNEVTKSDTYPLPRIDDLLQNTKKNCYMTTIDLRSSYWQVMVREADRDKTAFVCPLGTYRFKRMPFGLKNAPATFQRLIDRLRSCAALKDVTVLAYLDDLLIISEGFQQHLQDLEAVFRRLSEFKLHVNREKCTFAKERVRYLGHVITPDGVSPDPEKVSAVLNMLEPSNLKHLRTFLQTCSWFRKFIPNFSKIAEPLTRLTKKNYTWIWGPEQTQAFKELKRLLTTAPVLVQANFKQPLVLRTDASNYALGAVLAQGEGKDERPIEYASRLLTAAERNYSTTEREALAVVWAVERFRPYLDGQPIIIGSDHQPLRWLLSLKSPAGRLVRWALKLQEFDIRFEYTPGKANVVADTLSRPICSNETQNNCGICSVICDQPSKSPTQLRQDQLTDPEIQKIITELEGVDELAAKRWSERGFLMEQGVLYRLNPDSDAEAPQLVIPAHQVTDVLKELHDAPTAGHAGIDRTYQQVSRLFYFTGMRRIITDYVKACIHCQRYKAANTKPPGLLQTPVMNQRNEVLAVDLFGPLPPGKQGERWILLIEDTATRWTELFPLKEATAEACAHVLIEEYFMRFGLPRRLVSDNGVQFISAVMRQCMSILGIKQNLIPLYHPEANPAERKNRDLKTLLAQLVECMSPAYLSFGREMRSPTEVTHDLRAVLDKDNFVPQITPYLRKFVNSFSAVRERVETLQDKAKGYADRSRRPIETFNEGDMVLIKSHVLSKSAKGLTSKFVPKRDGPYRIVKKVSPTTYHVAHVDKPDEVLGKYHVNDLTLYRENQSDALPRPVMPKKKRGRPPNNVKTDSRVPGHMTTRHAEPCAEAPRLSPAAGGMVGLAPVPQPSSNEMLVQERGRPPGLEGEYVANRPVRHSRGRMPARYT

Summary

EMBL
GFTR01008566    JAW07860.1    IAAA01017336    LAA03833.1    GEZM01007731    JAV94970.1    + More
KQ972234    EFA12514.2    KQ971307    KYB29879.1    KYB29880.1    GFTR01008489    JAW07937.1    GACK01009040    JAA55994.1    GACK01009041    JAA55993.1    GALX01005355    JAB63111.1    GACK01009043    JAA55991.1    GACK01000334    JAA64700.1    GFAA01003652    JAT99782.1    GACK01009042    JAA55992.1    GACK01004027    JAA61007.1    LBMM01011454    KMQ86828.1    GEGO01002704    JAR92700.1    GACK01009039    JAA55995.1    GFTR01008516    JAW07910.1    GBBI01004690    JAC14022.1    LBMM01010896    KMQ87169.1    GFTR01008518    JAW07908.1    GECU01030157    GECU01020076    JAS77549.1    JAS87630.1    GGLE01001609    MBY05735.1    KF925840    AHN53418.1    LBMM01010852    KMQ87188.1    GFTR01008424    JAW08002.1    GEZM01020516    GEZM01020515    JAV89256.1    GFAC01005811    JAT93377.1    LBMM01004568    KMQ92283.1    GGLE01003869    MBY07995.1    GEFM01006999    JAP68797.1    GEGO01001242    JAR94162.1    GEGO01004488    JAR90916.1    GEGO01003620    JAR91784.1    GCES01095459    JAQ90863.1    KQ972733    KXZ75794.1    GEZM01046053    JAV77555.1    GGLE01007069    MBY11195.1    GEZM01035170    GEZM01035168    JAV83378.1    GEZM01099479    JAV53309.1    GACK01002722    JAA62312.1    GEGO01001548    JAR93856.1    LBMM01010645    KMQ87338.1    GFJQ02004522    JAW02448.1    GACK01003086    JAA61948.1    GACK01000363    JAA64671.1    GEFM01006971    JAP68825.1    GACK01000610    JAA64424.1    GAMC01021623    GAMC01021621    JAB84934.1    GACK01009547    JAA55487.1    GEZM01001047    JAV98195.1    GACK01009195    JAA55839.1    GEFH01002290    JAP66291.1    GACK01004001    JAA61033.1    GFTR01008624    JAW07802.1    GBHO01002002    GBHO01001990    JAG41602.1    JAG41614.1    GBBI01004634    JAC14078.1    KK112080    KFM56688.1    GBIH01000760    JAC93950.1    GFAA01003693    JAT99741.1    LBMM01008414    KMQ88902.1    GACK01009237    JAA55797.1    GAKP01022624    JAC36328.1    GEZM01005662    GEZM01005661    JAV96000.1    GFTR01008089    JAW08337.1    GACK01004074    JAA60960.1    KK119366    KFM75488.1    LRGB01003288    KZS03371.1    KK113242    KFM59673.1    GACK01003909    JAA61125.1    AFYH01233110    GEDV01001135    JAP87422.1    LRGB01002748    KZS06406.1    GEGO01004785    JAR90619.1    KK114971    KFM63831.1    KK118759    KFM73794.1    AAZX01023814    KK115210    KFM64429.1    KK118857    KFM74035.1   
Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF03732   Retrotrans_gag
PF17919   RT_RNaseH_2
PF09668   Asp_protease
PF00077   RVP
PF13358   DDE_3
PF01498   HTH_Tnp_Tc3_2
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR017956   AT_hook_DNA-bd_motif       
IPR041577   RT_RNaseH_2       
IPR005162   Retrotrans_gag_dom       
IPR003034   SAP_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR018061   Retropepsins       
IPR002492   Transposase_Tc1-like       
IPR009057   Homeobox-like_sf       
IPR038717   Tc1-like_DDE_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF46689   SSF46689       
Gene 3D
PDB
4OL8     E-value=5.25291e-72,     Score=693

Ontologies

Topology

Length:
1149
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02585
Exp number, first 60 AAs:
0.01243
Total prob of N-in:
0.00122
outside
1  -  1149
 
 

Population Genetic Test Statistics

Pi
381.579961
Theta
186.49362
Tajima's D
3.084998
CLR
0.378911
CSRT
0.982700864956752
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号