SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12637
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.02 Nuclear   Reliability : 1.949
 

Sequence

CDS
ATGTCTCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGCTCGCTCACGCGGCCCGCACGCACATAGACACCCTCCAATCTCTACAATCCCGCTTTTACAGGTTAGCCGGCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATCCAGAAATACATGAAGTCCGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCCAGTCACCGTCGATGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACATTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAGCTCGACAAAATTTCATGGCTTTTAAAATCACATTGGTGCTATAG
Protein
MSLRNKVTLYKTCIRPVMTYASVVLAHAARTHIDTLQSLQSRFYRLAGGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRCPRHVLTDPSDPITFALDAFSSNTRSRLRDPGNRTRRARQNFMAFKITLVL

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
161
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.36439
Exp number, first 60 AAs:
1.36439
Total prob of N-in:
0.27517
outside
1  -  161
 
 

Population Genetic Test Statistics

Pi
140.214033
Theta
139.307299
Tajima's D
0.020453
CLR
0
CSRT
0.372381380930953
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号