SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12599
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Guanylate cyclase      
Location in the cell
Nuclear   Reliability : 2.61
 

Sequence

CDS
ATGGAAGAAATTTTGATTGCGCTCAAAGAAATAAAGAAAGACCTGGACGAGCAGAGACAAGAAATCCGAGCAACTGGAATTAATGTTACGGATAAAGTATCAAAAAATGTAAACAAAATGCTCGAAGAAAAATTCCTACTAAAGCACTGCGACATACAAGAAGTCAGGAGACTGGGAAAGAAAGAGGAACGACCACGCCCTATAGTAGTGACCTTCACAACACTAGGTACTAAAATTAAAAGCTGGAAACGAAGAAATACACTAAAAGATACCTATTTCTACATGAAAGAAGATTACCCGAAGTACGTGCTAGAAAAGAGGAAGGGCTTACAAGAGCAGCTACGTATAGAAAGAGAGAAGGGAAATACAGCGTTATTGAAGTATGATAAATTGATCATCCTGCCCAAAACCAATACGAAAAGAAAATTACCCACCTCACCAAACAGCGGCACAACTTCAAAAGTAAACGAGACCTCACAAATAAACAAGAAGAACAAGATTCAAAAACCTGGTACCCCCGTGATAAGATCCAACAGCATCTCCGAGGGAGTTGTTAAACCAGGCATGCTGAACTTCTTGCAATTGCCACCCTCCTCCAATTCAAATTCAAATTTAGTACTTAAGAACAATCAAACTAAACATCTTCCAAAACGGCTGGTCACCGAGGAAGATTACGACTACAACCCTCCAAGTGTAAACATTAACAGACAGCTTATAAGTAAAACAAATAAAGATAATGAACAAAAACTTTATATAATAACTTTCAACGTGAAAACACTATCTTCTTATGAAAAACTAATAGAATTAACAGAATCACTAAAATCAATAAAATCAGACATTATTGGAATGGCAGAAGTGAGACGTCTTGGGGAAAAAATAGAGGAATATGAGGATTTTATTCTTTACTACATGGGCCAGACACCTGGACAGTTCGGCGTGGGCTTTTTGGTGAGAAAAAAACTTAAAGTAAACATAGAGAACTTCACGGGCTTATCAGAACGAGTCGCTATATTAAACTTACAATTCCATGGGCAAAAACTATCAATCATTCAAGTCTACGCACCCACAGAAGCAGCAAATGAAGAAGATATTTCTTATTTTTATGAGACAGTCAGAAGGGCTAGGGAGTTAGCGCATAAAGACTATATCATAATGGGCGACTTCAATGCTAAGATAGGTAAACCAAGACACGAAGAATTCTTGATTGCAAAACCATTTGGTCTTGGTATAAGAAATGACAGAGGCCAAAAATTGATAGATTTCGCTCTAGAAACTAAGACAGCAATAATGAACACATACTATCATAAGAAACCAAACCGCAGATGGACATGGCGCTCACCAGGTGGCGCATATAAAAATGAGATCGATTACATTCTATCTAACATACCGCAGAAGTTTCATAATGTGGAAGTTCTAAATATCAACTACCCATCAGACCACAGGCCAGTGAGAGCAACCATATCTCTTGAAAAAATAAAAATATCCAGGACTAGATACAAGACCAACCAGTGTGCGAGTCTAAAATACGAAAGCGAAATACTCAGATTCAGATTAAATCTCCAACTCCACCTGCTACGTGCCGATGACCAGAACTTGAAAGATACTGATAATATACAGACTCAATACAACAAAATAACTAATGCCATCTCGAGAAGCCTAGAAGAAACGCACAAGGAACACAATTCGTACAGACACAAAAAAATATCGCTACGCACAGAAAAACTCATGACTAGAAGAAAAGAATTACAGAAGACTAAAAACAAAACCAGAAGTATAAGAAACGAAATATCAGCTTTATACAAACTCATTAGCAAGTATATCAGGCAAGATTATGCAAAATACAGACAGGATACCATAACTAAGCACTTACAAGTTTCAGGCAGCACAAAAAAGGCTTATAAAGAGCTAGCACAAAATAAAACTTGGATCGAAGGACTTAAATCATCAGGAAAACAATCTATAATAACAAACCGCAATGATATCATTAATATGGCCACTGAATTTTATAAATCATTATACAGTAAAAAAACATCCACATATGTAGACATAACACCAAGCAGTAATATATCAAACAACGAAAAGGTGCAACCAATCACGGAATCTGAACTTATTGCAGCAATAAAAAACCTGAAAACCGACAAAAGCCCAGGCCCAGATGGCATTTCAAACGAAGCTTTAAAGGCAGCTGACAGAATATTAGCGCCACCTGTGGCAAAATTGTTTAACCAGATATTAGAAAATGCTGAGATCCCCATCCAATGGACAGAATCAAATATAATTTTAATCTATAAAAAAGGAGATCCAAAGGACATAACAAATTACAGGCCTATTAGTTTACTGTCTTGTTTCTATAAACTCTTTTCGTCAATTATAAACAACAGAATCAGTGATTCGCTAGAGAAAAATCAACCAATTGAACAAGCAGGATTCAGAAAAGGTTTTTCTACAGTGGACCACATTCACACCTTAGAACTCTTGATAGAAAAATACCAAGAAAAACAGAGAACACTATACATTGCATACATAGACTACCAAAAGGCTTTTGACACTGTGTCACATGATAGTGTATGGAAGTCGTTAAAAAACCAAGGGGTGAATGATAAATATATACAGATAATTAAAAACATTTATAAAACTAATACAAGTAGAATAAAACTAGAATCTATAGGCCCAAGATTTTCTATCAAAAGAGGTGTAAGACAGGGAGACCCCATGTCTCCAAAAATTTTCATTGCCATACTTGAATCAATATTTAGACAGCTAGATTGGAAAAACCTCGGCTTAAATATTGAAGGTAAATATTTGACTCATCTCCGCTTTGCAGACGACTTAGTAGTGCTGGCAGAATCAAGTTCAGAACTTCAATACATGGTTGAGTCTCTCCACAGAGCCAGCATTAAAGTAGGCTTAGAAATGAATGCAACAAAAACTATGGTAATGACAAATAGTGCTAGAAAGAAAATAACAGTCGGAAACGAACTATTGAAATACACAGACCACTATATTTACTTAGGAAAACAGATCAGCTTTGAAAGAAAAAACAATGAGATGGAGATTGGAAGAAGAATCCAACACACCTGGAACAAGTACTGGAATTTACGTGAAGTATTTAAAAGTACGTTGCCAATATACTTAAAAACCAAGGTTCTAAATTCCTGCATTCTACCATGCTTGACTTATGGCTGCCAAACTTGGAAGTTTACATCAAAGGCCAATAATCTAATAGTAAGCTGCCAACGAGGAATGGAGCGAAGTCTGCTGAATATAAGAAAGATTCAAAAAATCAGACACACAAAAATCAGAGAAAAAACAAAATCTATAGATGCTCTTGAATATGCCAGAAACTTAAAGTGGAAGTGGGCTGGTCATGTAGCCAGACTTAAGGACCAGAGATGGACTGCAAGAATAACTGCATGGGAAGGGCCACAAGGGAAAAGAAAAAAGGGTCGCCCGATATCAAAATGGGAGGATGATATAAAAGCTATCGCTGGCCCTCGATGGATACAGGTAGCTCAAAATAGAACCAAATGGAAGGACTTGGAGGAGGCCTTCACCATGTTTAATGGGTTCCTGCCAAACATAAGTGAAGAAAATTAA
Protein
MEEILIALKEIKKDLDEQRQEIRATGINVTDKVSKNVNKMLEEKFLLKHCDIQEVRRLGKKEERPRPIVVTFTTLGTKIKSWKRRNTLKDTYFYMKEDYPKYVLEKRKGLQEQLRIEREKGNTALLKYDKLIILPKTNTKRKLPTSPNSGTTSKVNETSQINKKNKIQKPGTPVIRSNSISEGVVKPGMLNFLQLPPSSNSNSNLVLKNNQTKHLPKRLVTEEDYDYNPPSVNINRQLISKTNKDNEQKLYIITFNVKTLSSYEKLIELTESLKSIKSDIIGMAEVRRLGEKIEEYEDFILYYMGQTPGQFGVGFLVRKKLKVNIENFTGLSERVAILNLQFHGQKLSIIQVYAPTEAANEEDISYFYETVRRARELAHKDYIIMGDFNAKIGKPRHEEFLIAKPFGLGIRNDRGQKLIDFALETKTAIMNTYYHKKPNRRWTWRSPGGAYKNEIDYILSNIPQKFHNVEVLNINYPSDHRPVRATISLEKIKISRTRYKTNQCASLKYESEILRFRLNLQLHLLRADDQNLKDTDNIQTQYNKITNAISRSLEETHKEHNSYRHKKISLRTEKLMTRRKELQKTKNKTRSIRNEISALYKLISKYIRQDYAKYRQDTITKHLQVSGSTKKAYKELAQNKTWIEGLKSSGKQSIITNRNDIINMATEFYKSLYSKKTSTYVDITPSSNISNNEKVQPITESELIAAIKNLKTDKSPGPDGISNEALKAADRILAPPVAKLFNQILENAEIPIQWTESNIILIYKKGDPKDITNYRPISLLSCFYKLFSSIINNRISDSLEKNQPIEQAGFRKGFSTVDHIHTLELLIEKYQEKQRTLYIAYIDYQKAFDTVSHDSVWKSLKNQGVNDKYIQIIKNIYKTNTSRIKLESIGPRFSIKRGVRQGDPMSPKIFIAILESIFRQLDWKNLGLNIEGKYLTHLRFADDLVVLAESSSELQYMVESLHRASIKVGLEMNATKTMVMTNSARKKITVGNELLKYTDHYIYLGKQISFERKNNEMEIGRRIQHTWNKYWNLREVFKSTLPIYLKTKVLNSCILPCLTYGCQTWKFTSKANNLIVSCQRGMERSLLNIRKIQKIRHTKIREKTKSIDALEYARNLKWKWAGHVARLKDQRWTARITAWEGPQGKRKKGRPISKWEDDIKAIAGPRWIQVAQNRTKWKDLEEAFTMFNGFLPNISEEN

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
Similarity
Belongs to the integrin beta chain family.
Feature
chain  Integrin beta
EC Number
4.6.1.2
EMBL
FJ265563    ADI61831.1    ODYU01008249    SOQ51673.1    FJ265562    ADI61830.1    + More
FJ265564    ADI61832.1    FJ265561    ADI61829.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    GBBI01004876    JAC13836.1    FJ265549    ADI61817.1    GBGD01000380    JAC88509.1    FJ265542    ADI61810.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    RSAL01000057    RVE49824.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    FJ265551    ADI61819.1    JARK01001655    EYB84321.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001475    EYB97550.1    JARK01001337    EYC34625.1    JARK01000063    EYC44387.1    JARK01000173    EYC41342.1    JARK01001338    EYC33297.1    JARK01000388    EYC37469.1    JARK01001389    EYC10874.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001497    EYB95322.1    JARK01001370    EYC16150.1    JARK01000302    EYC38674.1    JARK01001372    EYC15614.1    JARK01001344    EYC28216.1    JARK01001401    EYC08686.1    JARK01000008    EYC46079.1    JARK01001340    EYC30744.1    JARK01001421    EYC04912.1    JARK01001357    EYC20551.1    JARK01001581    EYB88505.1    EYC03125.1    JARK01000161    EYC41641.1    JARK01000109    EYC42952.1    JARK01001582    EYB88498.1    EYB95049.1    JARK01000146    EYC42042.1    JARK01001618    EYB86258.1    JARK01001637    EYB85284.1    JARK01001346    EYC26445.1    EYB85282.1    JARK01000177    EYC41210.1    EYC41209.1    EYB85285.1    JARK01001612    EYB86585.1    JARK01001531    EYB92324.1    QFQQ01000179    PZR20596.1    JARK01001568    EYB89432.1    JARK01001736    JARK01001462    JARK01001379    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01000132    EYC42415.1    JARK01001348    EYC25048.1    EYC25050.1    JARK01001407    EYC07212.1    JARK01000165    EYC41537.1    JARK01001524    EYB92970.1    EYB86256.1    EYB86257.1    JARK01000204    EYB98081.1    EYC40601.1    EYC25049.1    EYC30828.1    JARK01001424    EYC04315.1    JARK01000030    EYC45382.1    JARK01001473    EYB97806.1    EYC45383.1    JARK01000046    EYC44894.1    JARK01000460    EYC36749.1    EYC04317.1    EYC04314.1    JARK01001626    EYB85833.1    JARK01001428    EYC03684.1    JARK01001580    EYB88618.1    EYC04316.1    EYC25145.1    JARK01001621    EYB86109.1    EYC25046.1    JARK01001354    EYC21986.1    JARK01001359    EYC20105.1    GL379822    EGT48339.1    EYB98082.1    EYC40602.1    GBBI01004877    JAC13835.1    JARK01001502    EYB94855.1    EYC22263.1    JARK01001639    EYB85201.1    GDKW01001596    JAI54999.1    EYC11015.1    JARK01001365    EYC18010.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00362   Integrin_beta
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR029052   Metallo-depent_PP-like       
IPR017452   GPCR_Rhodpsn_7TM       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
IPR036423   SOD-like_Cu/Zn_dom_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
SSF49329   SSF49329       
PDB
6AR3     E-value=4.90954e-05,     Score=116

Ontologies

Topology

Subcellular location
Membrane  
Length:
1198
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0038
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1198
 
 

Population Genetic Test Statistics

Pi
1.037333
Theta
0.785982
Tajima's D
0.581575
CLR
123.220745
CSRT
0.621568921553922
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号