SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12574
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.911 PlasmaMembrane   Reliability : 2.409
 

Sequence

CDS
ATGCCAGATTCACTGTGCGCATGCGCATTGGAACAGCAGTGTTTTAAGACGGTATGTAATCAACAGCCCACTAAAACTATATTGCTTGGTACAGCGATATGCAATATTATGGATAATTCAGGTACGTTCTTGAGTACTGCCCGAATATTGGTAGATAGTGCATCGCAACGAGATCTGATTACTCTTGAATTTTGTAAGAGACTTAATTTACCAATTTATCCTTCCGAAACAAAGCAAGTGTGCGGAGTGGGTGATGTGAAAAATTCCATTGAAGGATATTGTTGTCTAACACTTTGCTCTTGTACTGAAGAATCAGTGCGTATTACAATACAACCTCTGGTAATCAATAAAATTACAGGTGAACTTCCTACCTCAAAGATCGATACTTCAAGTCTTAATTATCTAAAACACATTAAGCTAGCTGATGACAGATTCTCACAGCCTAGTGGTATAGATTTGATTGTGGGTTCCGATGTATTCTCTCGAATTTTACGACCTCATATAATTTCTAGGGCCCCCGGTGAACCTGTAGCAATTGAGACTTCATTAGGTTACATAATAGTCGGCCAGGCACCGGTATTAGCTCCCTCGATAGATAATTCATACTATACACATTGCACCTTTGGTGAGGACAATTTGGATAATGAGAATAATGTTTGTATTGGTAATTTTTTGAAATTAGAGGATATTCCAGACGTCAAGACATACACGGAACAGGAAGAGGAGTGTGAAAGCCTTTATAGACAAACGACTACTCGTGATAGCTTAGGTCGTTACATTGTCTCGTTACCATTCAAAGATACTCCTAGTAAGCTGGGTGACTCATTGCAAGCATCAATGCGTAGATATCTTTCATTGGAACGTAAGCTGCTATTGGAACCCGAAATGAGACAAGAATACGATAAAGTCATTAAGGACTATTTAGAAAAGGAATATTTAAACCCATGTTCTAGAAATATAAATGAGTCCTCACTCCAGTATGTTATTCCACATCACGGCATCATTCGAAAAGATAAAAGTACAACAAAATTACGGGTAGTATTGGATGGCAGTATGAAATCATCATCGGGACTGGCACTGAATGATATATTACAAGTCGGACCGAATTTGCAAAACGACCTTTTTAGAATAATTTTAAATTTCAGACTTTTTAATGTAGCGATTAGTGCTGACATTAGGCAAATGTACTTGAGGATTTTAGTAAAGGACGAAGATAGGAAATTCCTGCGAATGTTGTATCGCTTTGATCCAAGCGAGGAGATAAAACTTTACGAATTCACACGTGTGCCATTCGGTTTGTGTTGTAGTCCGTTCCTTGCGATCAGGACTGTGCGCCAGTTAGTGACGGACGAGGGATCACAATTTCCTCTCGCGGCTCCAGTAGCTGACAGTGACGTTTTCACTGACGATTTGGCTACTTCCTGTGCGAATGAAGAAACAGCGGTCGAACTTTCTAATCAACTTATTAAAATGTTTCATGCTGGTGGTTTTGATTTGGTAAAGTTTTCAAGTAACTCACCAGAGGTTCTTTCTAAAATACCCTCTTCACATAGAGAATTCGAAGTTATAGAATTTAGTCCAGATAGCTATTTAAAAATACTGGGACTAAACTGGCTTCCAGCCGAAGACGTATTCACATTCACAGTAAATTTACGGAACCGCGAATGTACTAAAAGAAATATTTTATCAGTTATAGCAAGAATTTGGGACTTAATGGGATTCGTAGCTCCTGTTACACTATGGGCCAAGCTCATCATTAAGTCACTATGGGCTAATAATATAGATTGGGATGAAACTCCTCGCCCTGAAATTGTAGCAGCTTGGCATCGATTCGTGTCTGAGTTGCCAATATTGGAAAATGTTAGAATACCACGACATACTGGCATTGTTATGGAGTGCATAGTTAGCTTATTGGGATTTGCTGATGCATCTGAAAAGGCCTATGGAGGTGTCGTTTATTTACATGTTTATTTTCCACAAACAAATAAGTTCACTATTACGCTTGTTTGTGCCAAATCCAGAGTGGCGCCGTTACGATGCGTGTCATTGGCAAGACTAGAATTATGCGGTAACTTGATTCTCGCAAAGTTGATGAGAGCAATTATTGACAGCTATTCTCATCGCTGTAAAATAAGTAATGTATTTGCCTTTACGGATAGCACCGTGGCTTTGGCATGGATTCACTCATCACCGGCTAGATGGCATACGTTTGTAGCCAACCGAGTAACAAAGATACAGGATGAAATACACCCCAGAAACTTTTATTTTGTATCGGGTAAAGAGAATCCAGCAGACTGTCTTTCACGCGGCTTAACACCATCACAATTGATGGAGCATCCTCTTTGGTTCAGTGGACCCCGATTTGCTCATCTACCCATTTCAGATTGGCCAGTTAAGAATTTTGATGCCACATCGATGACTGATATTCTAGAAATGAAACCAGCTATCATGCTATTCACAACTGATGATGCACGGAATGACAATATATTATACACGCTTGCATGTCGTATTTCATCATGGCCCAAGCTGGTCCGTATTGTACTTTATGTTCTCCGGTTTATTAAATTGGTACCGAGTAAATTTGATATTTCCCATTTAAAGGTGGCCGAAACGAATATCATCAAGGCCGTACAGCGAGTTCACTTTGATAAAGAACTTAAGAATATGGAGTCTGGCAAAATATTACCGCCTGCATTTCAACGGCTCAGAGCCTTTGTTCACGAAGGTATCTTTCGTGTTGGCGGGCGATTGGAGAATGCTCACTTGGAATTTGATAGTCAGCACCCTATTTTACTTCCCGCTCGTGACCATGTAGTGAACCTTTTGATAGACTATTATCACAAAAAGTATTTGCACACCGGACCGCAGCTCTTAATGTCTCTGATACGCCAAAACTACTGGATTCTCTCTGCTCGGAATATAATAAGAAAGCGAGTACAGCAGTGTAATATATGTTATAGAGCAAATCCCCGAAACCAATGTCCATTGATGGCTGATTTACCTGCTTGTAGAGTTCAAGAAACAAAGGCCTTTTATCACACTGGTATAGATTACGCTGGCCCATTACGTATTATTCCCTACAGGCGACGTGGTGTTCGTAGTCAAAAGGCGTATATTTGTCTGTTCATTTGTCTAGTTACCAAGGCAGTTCACCTAGAACTCTCAACGGACTTGAGCACAGCAGCTTTCCTGAATGCGTTCAAGCGCTTCATTGCGCGGCGTGGTCCAATCAAAGTAGTATATACCGACTGTGGAACAAACTTTTTGGGAACTCACTCATATCTCAAGGAAATGTATAAATTGATTTCCTCTGAGCAGTATGCAGATAAATTTGCAAATGAATTGCGTGATAATAATATAGATTGGAAATTCAACCCACCATCAGCCCCTCATTTTGGCGGTATATGGGAGGGTAATATTCGGAGCGTTAGAACTCATCTTAATAAAATAATTGGTAATCAGCTTCTCACTTTTGAAGAAATGTTGACTACACTTGCTCAAATTGAAGCATTATTAAATTCGCGACCTCTATCAGTTTTGAGTTCAGATCCATGTGACCCTCAAGCTCTTACTCCTGCACATTTTATAAACTTAACACCATTAAAATCACTACCTTCAGAAACGATAACGGAACATTCTAATCTCATCCAAAGGAAACGTATTGTAGACAGTTTGGTCCAGTCTTTTTGGAAAAGATGGAAACTTGAATATCTTAATACATTACAAGTTCGTAATAAATGGAAAAAAGATAGCACTCCTATTAAAACTGGCACAGTTGTACTGCTTCAATCTGAAAATAGTGCTCCTCTTAATTGGCCATTGGGTATAATAGAGGAAACTTTTCCGGGTCGTGATGGAGTTGTAAGGGTGGTTAACGTTAGAACGAAAACTGGTACTTATCGTAGACCTGTTGTTAAGGTTTATCCTTTACCAACACAGTAG
Protein
MPDSLCACALEQQCFKTVCNQQPTKTILLGTAICNIMDNSGTFLSTARILVDSASQRDLITLEFCKRLNLPIYPSETKQVCGVGDVKNSIEGYCCLTLCSCTEESVRITIQPLVINKITGELPTSKIDTSSLNYLKHIKLADDRFSQPSGIDLIVGSDVFSRILRPHIISRAPGEPVAIETSLGYIIVGQAPVLAPSIDNSYYTHCTFGEDNLDNENNVCIGNFLKLEDIPDVKTYTEQEEECESLYRQTTTRDSLGRYIVSLPFKDTPSKLGDSLQASMRRYLSLERKLLLEPEMRQEYDKVIKDYLEKEYLNPCSRNINESSLQYVIPHHGIIRKDKSTTKLRVVLDGSMKSSSGLALNDILQVGPNLQNDLFRIILNFRLFNVAISADIRQMYLRILVKDEDRKFLRMLYRFDPSEEIKLYEFTRVPFGLCCSPFLAIRTVRQLVTDEGSQFPLAAPVADSDVFTDDLATSCANEETAVELSNQLIKMFHAGGFDLVKFSSNSPEVLSKIPSSHREFEVIEFSPDSYLKILGLNWLPAEDVFTFTVNLRNRECTKRNILSVIARIWDLMGFVAPVTLWAKLIIKSLWANNIDWDETPRPEIVAAWHRFVSELPILENVRIPRHTGIVMECIVSLLGFADASEKAYGGVVYLHVYFPQTNKFTITLVCAKSRVAPLRCVSLARLELCGNLILAKLMRAIIDSYSHRCKISNVFAFTDSTVALAWIHSSPARWHTFVANRVTKIQDEIHPRNFYFVSGKENPADCLSRGLTPSQLMEHPLWFSGPRFAHLPISDWPVKNFDATSMTDILEMKPAIMLFTTDDARNDNILYTLACRISSWPKLVRIVLYVLRFIKLVPSKFDISHLKVAETNIIKAVQRVHFDKELKNMESGKILPPAFQRLRAFVHEGIFRVGGRLENAHLEFDSQHPILLPARDHVVNLLIDYYHKKYLHTGPQLLMSLIRQNYWILSARNIIRKRVQQCNICYRANPRNQCPLMADLPACRVQETKAFYHTGIDYAGPLRIIPYRRRGVRSQKAYICLFICLVTKAVHLELSTDLSTAAFLNAFKRFIARRGPIKVVYTDCGTNFLGTHSYLKEMYKLISSEQYADKFANELRDNNIDWKFNPPSAPHFGGIWEGNIRSVRTHLNKIIGNQLLTFEEMLTTLAQIEALLNSRPLSVLSSDPCDPQALTPAHFINLTPLKSLPSETITEHSNLIQRKRIVDSLVQSFWKRWKLEYLNTLQVRNKWKKDSTPIKTGTVVLLQSENSAPLNWPLGIIEETFPGRDGVVRVVNVRTKTGTYRRPVVKVYPLPTQ

Summary

EMBL
GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GALX01004947    JAB63519.1    + More
GEZM01085145    GEZM01085143    JAV60187.1    GEZM01054765    JAV73413.1    ABLF02030854    ABLF02067347    LBMM01009202    KMQ88311.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GGMR01002421    MBY15040.1    ABLF02006304    ABLF02036268    GGMR01017890    MBY30509.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMS01010524    MBY79727.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    ABLF02041863    ABLF02008594    GBHO01044643    JAF98960.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GFTR01008866    JAW07560.1    LNIX01000007    OXA51795.1    LNIX01000069    OXA36894.1    ABLF02039606    KK114194    KFM61875.1    LNIX01000016    OXA46198.1    LNIX01000002    OXA60848.1    ABLF02036131    ABLF02041527    ABLF02064049    LBMM01009551    KMQ88039.1    GDHC01006469    JAQ12160.1    ABLF02025193    GGMR01013370    MBY25989.1    GBBI01004211    JAC14501.1    GGMR01018294    MBY30913.1    GBRD01007977    JAG57844.1    OXA59522.1    ABLF02035780    GDHC01016727    JAQ01902.1    GBHO01007061    JAG36543.1    GBHO01007689    JAG35915.1    GBBI01004408    JAC14304.1    GBBI01004410    JAC14302.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    LBMM01010405    KMQ87487.1    ABLF02005684    ABLF02008636    ABLF02065931    JXUM01113346    KQ565681    KXJ70776.1    GFTR01008874    JAW07552.1    GGMR01016460    MBY29079.1    LNIX01000036    OXA39969.1    LBMM01008464    KMQ88855.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GGMR01018506    MBY31125.1    GDHC01014057    JAQ04572.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    LBMM01012188    KMQ86362.1    LBMM01009645    KMQ87967.1    GGMR01010750    MBY23369.1    LBMM01010417    KMQ87475.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01007859    KMQ89359.1    GBHO01023090    JAG20514.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    KQ458473    KPJ05885.1    LBMM01009964    KMQ87756.1    ABLF02028666    ABLF02066713    ABLF02042806    GGMS01006636    MBY75839.1    GGMS01014951    MBY84154.1    GDHC01019528    JAP99100.1    GDHC01014268    JAQ04361.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GDHC01002235    JAQ16394.1    GGMR01014165    MBY26784.1    GGMS01009443    MBY78646.1    GBHO01044316    JAF99287.1    LNIX01000018    OXA45284.1    LBMM01009888    KMQ87813.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1313
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0989599999999998
Exp number, first 60 AAs:
0.01558
Total prob of N-in:
0.00121
outside
1  -  1313
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.404568
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号