SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12572
Pre Gene Modal
BGIBMGA001530
Annotation
PREDICTED:_small_conductance_calcium-activated_potassium_channel_protein_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.953
 

Sequence

CDS
ATGGCGGAGAATTTTAGACGAGCATACGGCCCACCTGATGGTGAGTGGTTACCGTCGCCCATGGACTTCAGCAATGCCAGAGGCAGGGCCAAGCCGCTGCCTACCGCTGCAATTGCAGCCTATCGAATTGCAAACGGATTAAGCTTAGGATCCGCATTGACAGAATACTTCGGTGTATTTCAGCTGCGAAAGCCGGTGTCGACACTCTCGATCCCGGGTGCGATGAAGGCTTACTCCGGCGGGGGGCGGGACGCGAGCGGGGAGGAGGCAGGCGTAGCTCTAGTTGGCGTTCACAGCGAGTATCCACGCTTCGGAGAAGAACGGGCTCTGGGCGGCGGCACGTACAAAGGCGGAGGGACAGCCAAGCACAAACCCAACATAGGATATAGCTGGAAGTTTCGATTGAGATGTCTATTAGACGAAAAATCTTTGTTAGAGGTAGCGTCAAGTGGCGTTATAGAATTAAAACAAAAAACTGCTGATGCGGCTGCAAAAGCCTTAATAGTAAAATGTGTACCCGATAAGTACTTGGACATCATAAAAGATGCAACAACTAGCTACACAATGTTAGCCAGTCTGGATAAAGTTTTTGAGAGAAAAGGTATTTTCACTAAATTACACTTGCGAAGAAAGTTATTGTCTCTTAAGCTGAGGGATGATAAATTGGAAGACTATTTCATGAGATTTGAAAGTCTGATTAGAGAAATAGAAAATATTGATAAAAAGATGGATGAAGAAGATAAAATATGTTATTTGCTGACGGGTATGTCGGAAAAGTACAACACAGTGATAACTGCTATTGAAACAATGTCTGCAGATAAAATTGACATGGAGTTTGTCAAGGCTCGGTTATTGGACGAAGAACTCAAACTGAATAATAAAGGTGAAGAGTATAATGATACAAAGAATGATGTAAGTTTTACTGCCTCAAGTGTAGAATGTTATCGTTGCCACAAAAAGGGCCATTTTGCACGTGAATGTAGAAGCAGAGGTGGCTATTCAAGGAGAAACATTAATAATAAAGGTATATGTGGTAAAAACAGAACTGGAGAACAAAATAATATGACAGAAAGCATCCCAGAGAATAAATATAATTTTCTAGCAATAACGGAGTGTAATCTAAGTAGAGAAGACAAATTTATAGAATTTATAATAGATTCAGGAGCTACAGAAAATCTTATCAAGGAAGAATTAGAGAAATACATGTATGAAATTAAAAAACTACCAGATAAAATAAAAATTAAGATTGCAAATGGAGAAATATTAGAGGCTGACAAGAAAGGAAAGATAACCATAAGAGATAAAAATAATAATACTATAAATATAGAAGCGTTAATGGTCCCAGGGATTTATCATAATATAATATCTGTAAGAAACTTAAATATGAAAGGAAATAAAGTTGTTTTTACAAAATTTGGAGCACAAATAATAAATGGAAGAAAAGTCTTAAAATGTTCAGATAGAAATGGTTTATATATAGTACAAGGCGAAATAATACTAATAGAAGAAGCGAACTCAAGTGTACAGCAAGACAAAAATATTTGGCACCAACGTCTCGGACACTTAAATAGGAAATCATTAAAAATTATGGGTTTACCTGTGTCTGATGAAACATGTGGTCCTTGCATGAAGGGAAAATCTACTCGTTTACCATTCTATCCAGTTGACAGGCCAAGAAGTAGAAAAATAGGAGAATTATTGCATACAGATATTGGAGGTCCTGTATCACCAATTTCTTATGATGAAAAACAATATTACCAGACCATAACTGATGATTTTTCTCATTTTGTGACTGTTTATCTATTAAAGAATAAATCTGAAGCCACAAGAAATTTAATAAATCATATAAAGGAGTTAGAAAGACAAAAGGAAACTAAAGTTAAACGCATAAGATGTGATAATGGTGGAGAGTTCACCGCTGGCTGTTTGAAGCAATTTTGTATGGAAAATGGAATTATAATAGAGTATAGTCAACCTTACACACCACAACAAAATGGTGTGGCAGAGAGGCTAAACAGAACATTACTAGATAAGTCAAGAACTTTATTAAGTGAAACTGGATTACCTAAATATTTGTGGTCTGAGGCTATAATGTGTGCAGCATATCAATTGAATCGATGCCCATCAAGATCTATAAAGTATAAGATACCAGCTGAAATATACTACGGACTAGAAAATGTTAACTTGAACAAGTTAAAGGTATTTGGTTCTAAAGCATGGTATACGTGTGTCCCACAGAATAAGAAATTAGATAATAGAGCTGAAGAAGCCATTATGGTTGGCTATGGCAAACAAGGTTATAGATTATGGAATCCAAAAACAACAGAAATAATATTCTGCAGAGATGTCAAGTTTGATGAAAAGTACTATGAACATAAAAACAGTATTAAAAATAACAACTATATTTATTTACCAGAAGAGGACACAAAAAATGAAGTTATGTGCAATGATAAAAATAAAATTGAGGAAGAAAAAGTAATACAGAAAAATGAAGAGACAGACACAAAAAGAACTAGATCAGGAAGGATAATAAAGCAACCTGATTATCTAAAGAATTTTGGGACGTACACAGCATATTGTTACTTAGTGTGTAATGACCCAGAAAGCTATGAAGAAGCGATAAAAGAAGTTTCATGGAAAGAAGCGATACATAAGGAATTAGCAGCACTTGAGAACTTACAAAGCTGGGAAGAGACTAAACTACCGAAAGGAAAATTAGCTATAGACACTAAGTGGGTTTTTAGAACGAAAGACGATGGCACTAAGAAAGCCAGATTAGTCGCTCGAGGTTTTCAAATAAAAAATTATGAGAATGAAATATTCTACAGTCCTGTAGTAAGAATGTCTACGATAAGAGCATTTTTTGTAAAAGCTATCCAAGAAGGATACAAATTAAGGCAATTGGATATTCCTACAGCCTTTCTCAATGGATTTCTTGATAGTGAAGTTTATATAAAAATACCCAAAGGCAAAGAAAACAAAGATGGAATAGTTTTGAGGTTAAAGAGAGCATTGTATGGATTAAAAGAAAGCCCTAAATGCTGGAACATGAGATTTGATGAATTTGCAAGAAAGAATGGATTGATACAGATACAGAAAAAAATTATTAATAAATTGAAGCAAGAATTTAAAGCTAAAGATTTAGGACAGATTGAGAAATATCTTGGTATGGAAATTAAACAGGAAGAAAGTAAATTAACGATTAAACAAGAAAAGATAATTGAGAAGATACTAGAAAAATTTGGAATGTCAGAATGTAAAGGTATAGGAACACCTATGGAGGTAAATTTTCAAATAAACAAAAATGAGAAGATTATTGATGTACCATATCGACAACTCATAGGAAGCATAATGTATTTGGCTACTATGTCCAGACCAGATCTGCAGTTTGCTGTATCATATCTTAGCAGATACCTAGACTGTCCTACTCAACAGACTTGGAAAGCTGGAAAGAGAATTCTGCAATACCTAAAAGCTACAAAAGACAAAATGTTAGTTTTTCAAAAAAGGAATAATCTAGATGTGGATTTATGTGCATATTCAGACTCTGATTGGGCAGGTGATATTGTTGATCGCAAAAGTGTCAGTGGGGGTATCATAATGTGTAGTGATAATCCTGTATTTTGGTACTCTAGAAAACAAAGTTGTGTTGCATTATCGACAGCAGAATCAGAGTACATTGCTAGTGCTTGTTGTGCTCAAGAGTTAGTGTATTTGAAAGGTGTACTGTGTGATTTTGGATATGAATGTAAATTGACTTTATTTATGGATAATAAGGGAGCAATATGTTTAGCGAAGTCAAATGAAAACTCTAAAAGGAGTAAGCATATTGATATAAGGATGCACTATATTAAGGACTTGGTGAGGAATAATGTATTAGATATTGAATATGTGTCATCTGATAAAAATATTGCTGATATTTGTACAAAATCTTTATGCAAAGAAAAGTTAGGTAGGAGAAAGGCGTTATTTGAAAAAAGAAAACGGATAAGTGACTACGCTTTAGTAATGGGGATGTTTGGAATTATAATTATGGTAATAGAAAATGAACTCTCAAGTGCCGGTGTTTATACTAAGGCATCAATATATTCACAGGCGTTAAAGACGCTAATATCAATGTCGACTGTGATTTTACTTGGCCTAATCGTCGCGTATCATGCTTTAGAAGTACAATTATTTATGATAGACAACTGCGCCGACGACTGGCGGATAGCAATGACGTGGCAAAGGATAGCGCAAATCGGCCTCGAACTGGCGATATGCGCCGTTCACCCCATCCCTGGACAATATACTTTTACGTGGACGACAAAGTTGGCCAACAAGGGTGGAGTGATAGGCGTTGAAGTTGTTCCTTATGACGTCACGTTGTCACTGCCGATGTTCTTTAGGCTGTATCTTATATGCAGGGTCATGTTACTTCACAGTAAATTGTTCACGGACGCTTCATCCAGAAGTATAGGAGCTTTAAACAGAATTAATTTTAATACTAGATTCGTCTTGAAGACATTAATGACAATTTGCCCTGGTACTGTATTATTAGTATTTATGGTGTCACTTTGGATAATCGCAAGCTGGACATTACGACAATGCGAAAGGTTTCACGACGAGGAACACGCTAATCTACTGAATGCGATGTGGCTAATAGCTATAACGTTTCTCTCCGTTGGTTTTGGTGACATAGTGCCAAACACATATTGTGGCAGAGGTATTGCTGTTAGCACCGGTATTATGGGAGCTGGATGCACAGCGTTATTAGTCGCGGTTGTTTCAAGAAAATTAGAATTAACTAGAGCCGAGAAGCACGTTCATAACTTCATGATGGACACACAACTTACTAAAAGACTGAAAAACGCAGCGGCTAACGTGCTTCGAGAAACGTGGTTAATATACAAACACACGCGACTAGTAAAAAGAGTTCATCCAGGAAGAGTGAGGACGCATCAGAGGAAGTTTTTGCTAGCTATTTATGCATTACGAAAAGTGAAGATGGATCAACGAAAACTAATGGACAATGCCAACACAATAACTGACATGGCAAAGACACAGAACACGGTCTATGAGATTGTCTCAGATATGAGCACGAGACAGGACACTATAGAAGAGAGGCTGACTAGTTTAGAAGAAAAACTAACAACGTTACAGGAACAAGTAAATAGTTTACCAGATGTTATGGCAAGGTGTTTACAACAATGCTGGGAGAGAGCTGAACAAAGAAGGAATTTTCTTCATCCAGACACCGCCGCTGTGCCTACGCCGCCATCGTCTACTATTACGCCTTATGCAAGAGCAATGCCGTCAGCGTCACATCCGTGGCCCCCGAGTCCGGTGCTGCAACCGTCAGCACGAACCCACTCGGCTCCAGAGAGCACGACAGCTCACTCTCCAACACCAGTCCAGCTGCAGCCTTCAAGCCCTGCTCCTCAAGTGACGCGGCCGCCCTTGCCCAGCTGA
Protein
MAENFRRAYGPPDGEWLPSPMDFSNARGRAKPLPTAAIAAYRIANGLSLGSALTEYFGVFQLRKPVSTLSIPGAMKAYSGGGRDASGEEAGVALVGVHSEYPRFGEERALGGGTYKGGGTAKHKPNIGYSWKFRLRCLLDEKSLLEVASSGVIELKQKTADAAAKALIVKCVPDKYLDIIKDATTSYTMLASLDKVFERKGIFTKLHLRRKLLSLKLRDDKLEDYFMRFESLIREIENIDKKMDEEDKICYLLTGMSEKYNTVITAIETMSADKIDMEFVKARLLDEELKLNNKGEEYNDTKNDVSFTASSVECYRCHKKGHFARECRSRGGYSRRNINNKGICGKNRTGEQNNMTESIPENKYNFLAITECNLSREDKFIEFIIDSGATENLIKEELEKYMYEIKKLPDKIKIKIANGEILEADKKGKITIRDKNNNTINIEALMVPGIYHNIISVRNLNMKGNKVVFTKFGAQIINGRKVLKCSDRNGLYIVQGEIILIEEANSSVQQDKNIWHQRLGHLNRKSLKIMGLPVSDETCGPCMKGKSTRLPFYPVDRPRSRKIGELLHTDIGGPVSPISYDEKQYYQTITDDFSHFVTVYLLKNKSEATRNLINHIKELERQKETKVKRIRCDNGGEFTAGCLKQFCMENGIIIEYSQPYTPQQNGVAERLNRTLLDKSRTLLSETGLPKYLWSEAIMCAAYQLNRCPSRSIKYKIPAEIYYGLENVNLNKLKVFGSKAWYTCVPQNKKLDNRAEEAIMVGYGKQGYRLWNPKTTEIIFCRDVKFDEKYYEHKNSIKNNNYIYLPEEDTKNEVMCNDKNKIEEEKVIQKNEETDTKRTRSGRIIKQPDYLKNFGTYTAYCYLVCNDPESYEEAIKEVSWKEAIHKELAALENLQSWEETKLPKGKLAIDTKWVFRTKDDGTKKARLVARGFQIKNYENEIFYSPVVRMSTIRAFFVKAIQEGYKLRQLDIPTAFLNGFLDSEVYIKIPKGKENKDGIVLRLKRALYGLKESPKCWNMRFDEFARKNGLIQIQKKIINKLKQEFKAKDLGQIEKYLGMEIKQEESKLTIKQEKIIEKILEKFGMSECKGIGTPMEVNFQINKNEKIIDVPYRQLIGSIMYLATMSRPDLQFAVSYLSRYLDCPTQQTWKAGKRILQYLKATKDKMLVFQKRNNLDVDLCAYSDSDWAGDIVDRKSVSGGIIMCSDNPVFWYSRKQSCVALSTAESEYIASACCAQELVYLKGVLCDFGYECKLTLFMDNKGAICLAKSNENSKRSKHIDIRMHYIKDLVRNNVLDIEYVSSDKNIADICTKSLCKEKLGRRKALFEKRKRISDYALVMGMFGIIIMVIENELSSAGVYTKASIYSQALKTLISMSTVILLGLIVAYHALEVQLFMIDNCADDWRIAMTWQRIAQIGLELAICAVHPIPGQYTFTWTTKLANKGGVIGVEVVPYDVTLSLPMFFRLYLICRVMLLHSKLFTDASSRSIGALNRINFNTRFVLKTLMTICPGTVLLVFMVSLWIIASWTLRQCERFHDEEHANLLNAMWLIAITFLSVGFGDIVPNTYCGRGIAVSTGIMGAGCTALLVAVVSRKLELTRAEKHVHNFMMDTQLTKRLKNAAANVLRETWLIYKHTRLVKRVHPGRVRTHQRKFLLAIYALRKVKMDQRKLMDNANTITDMAKTQNTVYEIVSDMSTRQDTIEERLTSLEEKLTTLQEQVNSLPDVMARCLQQCWERAEQRRNFLHPDTAAVPTPPSSTITPYARAMPSASHPWPPSPVLQPSARTHSAPESTTAHSPTPVQLQPSSPAPQVTRPPLPS

Summary

Pfam
PF00665   rve        + More
PF07727   RVT_2
Interpro
IPR039537   Retrotran_Ty1/copia-like        + More
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
6CNO     E-value=7.89115e-75,     Score=720

Ontologies

Topology

Length:
1816
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
128.39194
Exp number, first 60 AAs:
1.36523
Total prob of N-in:
0.06230
outside
1  -  1333
TMhelix
1334  -  1356
inside
1357  -  1368
TMhelix
1369  -  1388
outside
1389  -  1443
TMhelix
1444  -  1466
inside
1467  -  1501
TMhelix
1502  -  1524
outside
1525  -  1538
TMhelix
1539  -  1561
inside
1562  -  1567
TMhelix
1568  -  1590
outside
1591  -  1816
 
 

Population Genetic Test Statistics

Pi
187.34297
Theta
185.848767
Tajima's D
0.304123
CLR
0.499166
CSRT
0.462776861156942
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号