SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12569
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Guanylate cyclase      
Location in the cell
Cytoplasmic   Reliability : 1.594 Mitochondrial   Reliability : 1.996
 

Sequence

CDS
ATGAAGAAACGAATAGAACGAAACAAAGGCTCCAAGGTGTTCGCGAGAGATTTGTCTCTTGGGAAAAGCCAGTTGACAAGACTGAAGATCGATGATGGCAGGATCATTTCGTCCAAGCCTGAGCTTTTGAGAGAGGTCGAGAAGTTCTATGGACAGCTATACACATCTACTCGACAACCCGTGGAATATCTAGCAAAGGATCCAAGAGCTAGATTAGTCCGACACTATACCGAAGATATCCCCGACATCAGCCTGTGCGAGATTAGAATGGCTCTCAAGCAACTTAAGGACAACAAGGCACCGGGCGAGGATGGAATTACCGTCGAACTTCTGAAGGCGGGTGGAAAACCAGTCCTTCGGGCCCTACAAAATTTATTTAATTCCGTCATTCTCGATGGGAATGTGCCCCTGGCATGGACCAGAAGTGTGGTGGTACTGTTCTTCAAAAAGGGTGACAATACTCGTTTGAAGAATTATAGACCCATCTCACTTCTGAGTCATGTCTATAAGTTGTTCTCGAGAGTTATTACGAACCGTCTCGCGCGCAGGTTTGATGACTTCCAGCCACCCGAACAAGCCGGTTTCCGAAAAGGCTATAGTACCGTAGACCACATTCATACGTTGCGGCAGATTGTACAAAAGACCGAGGAATATAACCTGCCGCTTTGCTTAGCATTTGTGGACTACGAGAAAGCCTTTGATTCGATTGAAACCTGGGCCGTGTTACAGTCTCTCCAACGGTGCCAAATTGATTATCGGTATATCGAAGTGTTGAGGTGTTTGTATGAAAACGCTACTATGTCAGTCCGAGTACAGGACCGGGCTTCAGAACCTATCCTTCTGCAGCGGGGCGTGAGGCAAGGAGATGTTATTTCTCCGAAACTATTTACCGCTGCGCTGGAAGATGTTTTCAAAGTTCTGGACTGGAAAGGACTAGGCATCAACATAAACGGCGAGTACATAACTCACCTTCGGTTCGCCGATGATATTGTGATTATGGCCGAGACCATGGAGGACCTCAGTACAATGCTCAAAGACCTCAGTAGGGCTTCTATCCGAGTGGGTCTAAATATGAACAAAGAAAAAACAAAAATTATGTTGAATGCTCATGTAGCGCCCACTCCAGTAAAGATCGGAGGCTCTACGCTCGAAGTTGTTGACGAGTATATTTACCTGGGACACACTGTCCAGCTAGGTAAGTCCAACTTCGAAAAAGAGGTCAACCGTCGAATCCAGCTCGGATGGGCAGCGTTCGGAAAGCTACGTAAAATCTTCTCATCACAAATACCACAGTGTCTCAAGACGAAAGTCTTTGACCAGTGTGTGTTGCCAGTGATGACATATGGCACTGAGACGTGGTCGCTCACAATGGGCCTTATGAGAAGGCTCAAGGTCACCCAAAGAGCAATGGAGAGGGCTATGCTCGGAGTTTCCCTGCGAGACCAAATCAGAAATGAGGAGATTCGCAGGAAAACCATGGTAACCGACATAGCCCAAAGGATTGCGACACTGAAGTGGCAGTGGGCAGGACACATTGCTCGCGGAACAGATGGCCGTTGGGGCCAGAAGGTTCTTGAGTGA
Protein
MKKRIERNKGSKVFARDLSLGKSQLTRLKIDDGRIISSKPELLREVEKFYGQLYTSTRQPVEYLAKDPRARLVRHYTEDIPDISLCEIRMALKQLKDNKAPGEDGITVELLKAGGKPVLRALQNLFNSVILDGNVPLAWTRSVVVLFFKKGDNTRLKNYRPISLLSHVYKLFSRVITNRLARRFDDFQPPEQAGFRKGYSTVDHIHTLRQIVQKTEEYNLPLCLAFVDYEKAFDSIETWAVLQSLQRCQIDYRYIEVLRCLYENATMSVRVQDRASEPILLQRGVRQGDVISPKLFTAALEDVFKVLDWKGLGININGEYITHLRFADDIVIMAETMEDLSTMLKDLSRASIRVGLNMNKEKTKIMLNAHVAPTPVKIGGSTLEVVDEYIYLGHTVQLGKSNFEKEVNRRIQLGWAAFGKLRKIFSSQIPQCLKTKVFDQCVLPVMTYGTETWSLTMGLMRRLKVTQRAMERAMLGVSLRDQIRNEEIRRKTMVTDIAQRIATLKWQWAGHIARGTDGRWGQKVLE

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
Similarity
Belongs to the integrin beta chain family.
Feature
chain  Integrin beta
EC Number
4.6.1.2
EMBL
FJ265549    ADI61817.1    RSAL01000057    RVE49824.1    FJ265543    ADI61811.1    + More
FJ265544    ADI61812.1    RSAL01002362    RVE40503.1    FJ265542    ADI61810.1    RSAL01002130    RVE40575.1    FJ265551    ADI61819.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    KZ150072    PZC74016.1    RSAL01000220    RVE44071.1    MRZV01002136    PIK34564.1    KZ149985    PZC75698.1    MRZV01000899    PIK42833.1    AAGJ04050748    AAGJ04144474    KZ149907    PZC78256.1    FJ265562    ADI61830.1    ODYU01004088    SOQ43598.1    KZ150317    PZC71439.1    KZ150485    PZC70710.1    JARK01001677    EYB83167.1    EYB83168.1    JARK01001340    EYC31295.1    JARK01001351    EYC23395.1    KZ150108    PZC73382.1    FJ265561    ADI61829.1    JARK01000173    EYC41342.1    JARK01001462    EYB98997.1    JARK01000388    EYC37469.1    GBBI01004876    JAC13836.1    JARK01001370    EYC16150.1    JARK01001389    EYC11015.1    JARK01001639    EYB85201.1    GBGD01000380    JAC88509.1    MRZV01000249    PIK54411.1    JARK01001568    EYB89432.1    GBBM01001358    JAC34060.1    ODYU01004982    SOQ45402.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    GBGD01000453    JAC88436.1    FJ265564    ADI61832.1    EYC16151.1    UZAG01000503    VDO08661.1    GBBI01004877    JAC13835.1    GFAC01005640    JAT93548.1    JARK01001655    EYB84321.1    JARK01001434    EYC02684.1    JARK01001424    EYC04315.1    EYC04317.1    EYC04316.1    EYC04314.1    JARK01001438    EYC02111.1    FJ265563    ADI61831.1    GDKW01001596    JAI54999.1    JARK01001473    EYB97806.1    JARK01001736    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001517    EYB93530.1    JARK01001348    EYC25048.1    JARK01001362    EYC18843.1    EYC18844.1    EYC25050.1    JARK01000347    EYC38051.1    JARK01001378    EYC13977.1    EYC25145.1    JARK01001341    EYC29807.1    JARK01001406    EYC07496.1    JARK01001346    EYC26784.1    JARK01001349    EYC24735.1    EYC25046.1    JARK01001344    EYC28218.1    EYC02012.1    EYC25049.1    JARK01001630    EYB85641.1    JARK01001621    EYB86109.1    JARK01000460    EYC36749.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001531    EYB92324.1    EYC28635.1    JARK01001711    EYB81734.1    JARK01000248    EYC39628.1    JARK01001361    EYC19034.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    EYC30828.1    JARK01001365    EYC18010.1    EYB98081.1    EYC40601.1    JARK01001626    EYB85833.1    EYC16376.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00362   Integrin_beta
PF01826   TIL
PF13520   AA_permease_2
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR020846   MFS_dom       
IPR002293   AA/rel_permease1       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF57567   SSF57567       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
PDB
6AR3     E-value=1.39492e-06,     Score=126

Ontologies

Topology

Subcellular location
Membrane  
Length:
526
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.32212
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02900
outside
1  -  526
 
 

Population Genetic Test Statistics

Pi
56.608941
Theta
70.658686
Tajima's D
-0.727472
CLR
2.657042
CSRT
0.189690515474226
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号