SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12548
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.534
 

Sequence

CDS
ATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCAACTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATTAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGAAATGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTACAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MLATILNAAMTNCNFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459580    KPI99178.1    AF081101    AAC72919.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    ABLF02014862    ABLF02014866    ABLF02061908    KQ973342    KXZ75569.1    GGMS01004685    MBY73888.1    ABLF02008933    ABLF02029306    ABLF02029314    ABLF02060138    KK117880    KFM71667.1    ABLF02003961    ABLF02059872    GFTR01008038    JAW08388.1    ABLF02042518    ABLF02057746    ABLF02033757    KK113014    KFM59099.1    GALX01005300    JAB63166.1    GEZM01038405    JAV81653.1    GGMR01016114    MBY28733.1    JRES01000644    KNC29657.1    GGMS01000737    MBY69940.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    GBBI01004395    JAC14317.1    GGMR01003407    MBY16026.1    NEVH01012084    PNF30905.1    RPOV01000134    RPJ78669.1    GGMS01008766    MBY77969.1    NEVH01005938    PNF38077.1    NEVH01006736    PNF36716.1    NEVH01006721    PNF37225.1    NEVH01001355    PNF42855.1    NEVH01003017    PNF40781.1    JXUM01155316    KQ572171    KXJ68070.1    NEVH01010546    PNF32261.1    NEVH01007443    PNF35684.1    NEVH01000598    PNF43535.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01000280    PNF43672.1    NEVH01020071    PNF21969.1    GEZM01053022    JAV74219.1    NEVH01026386    PNF14434.1    AF012049    AAC24972.1    NEVH01023961    PNF17613.1    NWSH01000032    PCG80497.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    GFXV01006424    MBW18229.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    NEVH01007393    PNF35987.1    NEVH01011985    PNF31054.1    NEVH01007578    PNF35646.1    NEVH01012089    PNF30491.1    ABLF02066620    GGMR01000676    MBY13295.1    NEVH01009134    PNF33528.1    LBMM01010106    KMQ87671.1    NEVH01027074    PNF13841.1    GGFJ01001858    MBW50999.1    GFXV01007093    MBW18898.1    S59870    AAB26437.2    NEVH01026154    PNF14491.1    NEVH01020963    PNF20308.1    NEVH01017470    PNF24199.1    PYGN01000192    PSN51582.1    GBBI01001693    JAC17019.1    GGMS01012005    MBY81208.1    NEVH01016302    PNF25823.1    GGMS01006359    MBY75562.1    NEVH01019376    PNF22596.1    GGFJ01001857    MBW50998.1    ABLF02024246    GBBI01001646    JAC17066.1    GGMS01004444    MBY73647.1    PCG80496.1    ABLF02008463    GGMS01002992    MBY72195.1    NEVH01020940    PNF20481.1    GEDC01000337    JAS36961.1    GGFJ01002256    MBW51397.1    NEVH01019080    PNF22876.1    GGFJ01002257    MBW51398.1    KL813758    KFM83187.1    NEVH01021205    PNF19912.1    GGFJ01001842    MBW50983.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00124961,     Score=100

Ontologies

Topology

Length:
479
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.36851
Exp number, first 60 AAs:
0.00103
Total prob of N-in:
0.01348
outside
1  -  479
 
 

Population Genetic Test Statistics

Pi
52.061125
Theta
45.448096
Tajima's D
0.980028
CLR
55.386232
CSRT
0.651367431628419
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号