SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12543
Annotation
reverse_transcriptase_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 1.757
 

Sequence

CDS
ATGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACAGTAGACGCGATCCTTCGTGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACATCCTGCCCTGGTCCGTGATAGGGAGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTCCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTAAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCGGACGACACGTTAGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCCCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATCCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGATTCTGGAAGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCTGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAACCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAACAGGAAACGACTTGTCGTTGCCGAGTGTCGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAACCCTGGCCCTCTAA
Protein
MAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNILPWSVIGRALERHGVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVAPSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWILEAEALAADYQWRADLRARGVARPSPCVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGTEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKTGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQTLAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ150386    PZC71062.1    RSAL01000481    RVE41577.1    LBMM01024063    KMQ82623.1    LBMM01005707    KMQ91279.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    LBMM01019838    KMQ83439.1    LBMM01006671    KMQ90407.1    LBMM01005733    KMQ91252.1    LBMM01006657    KMQ90417.1    LBMM01004272    KMQ92618.1    LBMM01003679    KMQ93242.1    LBMM01006063    KMQ90967.1    LBMM01002052    KMQ95336.1    LBMM01006725    KMQ90373.1    LBMM01005948    KMQ91066.1    LBMM01008682    KMQ88705.1    LBMM01007036    KMQ90099.1    LBMM01004634    KMQ92224.1    LBMM01008448    KMQ88867.1    LBMM01003245    KMQ93755.1    LBMM01003988    KMQ92922.1    LBMM01008422    KMQ88894.1    LBMM01007425    KMQ89740.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01014956    KMQ84982.1    LBMM01004505    KMQ92346.1    LBMM01015025    KMQ84953.1    LBMM01014122    KMQ85315.1    LBMM01012412    KMQ86235.1    LBMM01005465    KMQ91492.1    LBMM01008278    KMQ89009.1    KMQ94772.1    LBMM01005474    KMQ91485.1    LBMM01005216    KMQ91703.1    GGMR01000779    MBY13398.1    LBMM01021647    KMQ83033.1    LBMM01004262    KMQ92649.1    LBMM01013668    KMQ85535.1    LBMM01004261    KMQ92650.1    GGMR01014195    MBY26814.1    ABLF02011238    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02005203    ABLF02041316    GGMR01015354    MBY27973.1    GGMR01015159    MBY27778.1    LBMM01003575    KMQ93366.1    LBMM01005845    KMQ91162.1    GFXV01002090    MBW13895.1    LBMM01006496    KMQ90570.1    ABLF02034925    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    ABLF02041886    GGFJ01001369    MBW50510.1    GGFJ01001727    MBW50868.1    GGFJ01001370    MBW50511.1    GGFJ01001439    MBW50580.1    GALX01004785    JAB63681.1    GGMR01012748    MBY25367.1    ABLF02004597    ABLF02041324    ABLF02004854    ABLF02041317    GGMR01004600    MBY17219.1    GFXV01003903    MBW15708.1    GGFK01005660    MBW38981.1    LBMM01015285    KMQ84870.1    GFXV01001748    MBW13553.1    LBMM01012322    LBMM01012138    KMQ86282.1    KMQ86387.1    GBXI01013438    JAD00854.1    APGK01005465    KB736249    ENN83233.1    ABLF02009991    ABLF02009992    ABLF02054952    GGFL01004044    MBW68222.1    AB593327    BAK38648.1    GALA01001777    JAA93075.1    GGMR01006838    MBY19457.1    AB593321    BAK38639.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF07776   zf-AD
PF00096   zf-C2H2
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
5IRG     E-value=0.0156391,     Score=91

Ontologies

Topology

Length:
511
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.591829999999998
Exp number, first 60 AAs:
0.3758
Total prob of N-in:
0.02209
outside
1  -  511
 
 

Population Genetic Test Statistics

Pi
47.290895
Theta
31.618982
Tajima's D
0.123875
CLR
0.400639
CSRT
0.408479576021199
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号