SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12540
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.706
 

Sequence

CDS
ATGATGGACAATTGTGCAAAGTTAGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCAGTGGAAGCACGCTGCCCCACGTATTCTGGGGGGGGCAACAATTGTCAGGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGCGCTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTGCAGTCAACCCCACCAGACCATCGGTGGGGAAAAAGAGGGGGCGAAGAAAAACCCCATTGCCATCTTCAAATGACGGCAGCGCGTCATCCTCCGGCACTGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGACTCCGGTGGTTTCGGGGTCTGCTGCTGCGTCGGAAGACGCGATGCCTGCTCCCCAGTGGGCACCAGTAAGGAGGAGGGGCGCGGTGTCACCGGCGACGTCAGTGGAGTCGATGTCGACGTCGGCTGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCGCTTGTTAATTTGGGTAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGTTACCGGAAAAGACTCCGGGAGGCAGCCGCCATGGTTAAAACGAGGCTGATCCCCACCATGTCCAAGCTCCATGACTTGGTAGCGAGCCGAGAGGTGGAGAGCAAAGGTCACGTCTCTCAGTTTGACTCCAGAGAGAGTCACATCCCGGGAGACACCCCGGCATTGCGGGGAGGGACTCCCCTGTTGCCGAGGCCCGCGCTGCCATGCCCTGGGCCCCCCGCGGGGGCGATGGATACTACTGTGCACTTGCGGTCCGCGATGAGTGCGGTGGCACCCATGCCAGAGCCCACCTCCGAGGCCCCTGTTTCGCTGGCGCCTACTCCTGCGATCCCTCGCCCTCCACGAAGGGTTGAGCTAAGGCCTGCGCCACCTCCGCGGATATCAGCCGCCCCTGCCTCTGCACGTAGAGGAAAGCTAAACCCTACGCCAGCGCGGGCTGAGGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCAACGCTACCGCGGCCCAGGCCTGCAGAGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTCACAGAGGCCATACAACATGGCTGCTGGGACGGAAGAAGTAGACCACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGCATTTCGCGGGCGGTGGCTGTTGAGGTTGGCAAGCACTTTGCCAGCCTCGAGAAGATACTCCGCTCCTCCAATGGCTCCGGAGACTGTGTCCCGGCACCAACAAACGCCGCCGTCCCGCGGGGCCAGGCCGCCCGGCCGACCTCCACCCCCACCTCATCCACAAGGTTGGCACGACGTGGAGGCCGCAATCAAAATAACAGGGGTACGGGTGCCCAAAATCCTGCCCTGAAATCCCAGCCCCGTCCCCTTCCTCCTCCCCCGTCAAGCATGGACGAGGGTTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGGTAGGCAACAGACAGAGGCTCTGGCAGCTCCCAGAGGGGGTCGAGCGCTGACCGCTGCAGCCCGAAGCACAGAGCTGGTGGCCGTGGCTGCTCCTCGCGAGAGTCGAGCACCGGCCACCAACAAGAAGCAGAACGCCAAGAAGAAGAAGACGCGCGCAGCGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCAGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCAGGCGCGCGCGGCCGTCAACTTAGCAGAAATCGGGGCAGAGGAAGGCCTCCGCTTCCGGCATACCGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCGGATAGTTCTGGTGTCGCAGACAGACTAGTGGCGACGCTCCGCGTGGCGCTGCCGGAGAATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATCAGGATCACCGGCCTGGACGACTGCGCCACCAAGGAGGAGGTGGCAGCTGCGATAGCCGCCCAAGGTGGATGTGCCTTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGATACTCCGGAGCTAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCTGCCACTTCCTTGGCTACTCCTCCGCCGGGAAGGTCAATGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGGCACGGCCTCGCTAGGTGCACCAGCTTAGTTGACCGCAGCGGTCTATGTTTCCGCTGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCTGGGCGTAGGGCAAACCACCGAGCGGGAGGCAAGGCTTGCTTCCCGTCCGGTGTTAATACTGAACGCAACCGGCGCCGAAAATCAAGGCGCCGGCAGAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAATGTTGCAATCCCCGCTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGACGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGACGATCCCCCCCTTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACTGTCGAGTTCGGGCATTTCCTGGACGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAACGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTGTTGGAGAGGTGGGCGAACGTGGCCGGCCTCTATTTGGTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTGTTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCAGTTGAGGTCGAGGACGAAGCGAGGTGGTTCCGGGACACGATGCGTCGCATCTGTGACGTGTCGATGCCCCGGATTAGCCCTCGACCTCCCAATCGCCAAGTGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCAAGGCGCCAGTGCGCGAGGCATCGCCGCCGTCGCTTGCCGCGGCGCAACGATCCGGTGGCGTTCGCGGTGGTAGAGGCCCAGCTGTACGGCGCATTTCGCGTCGCACAGAGGGCGTTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGGAGAGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCACATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCAGGGGGGATTTGTCGCTCCCGCTATGGGCGCGCCGCCGGAATACGACGGCGACGCCCCTGCTGAGGTGCCCCATATAACAGGGGCGGAGCTCCGTGTGGCAGTACGCAAAATGTGCGCAAAGGACACTGCACCTGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTATTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTGCCGTCCCATCGTGTTGTTGGATGAGGTGGGCAAACTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGATCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGTCGCTCAACAGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTGTGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGATGGGGTCGTACATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATATGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGGTGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCGGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTGCTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGAGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGGCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCTATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCAGCGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCTAGCCCTGGCCCTCTAA
Protein
MMDNCAKLVPQEGTARESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPRRSPIAGSMRSALASDSGAVNPTRPSVGKKRGRRKTPLPSSNDGSASSSGTEVPEKTMAIEEVTPVVSGSAAASEDAMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVKTRLIPTMSKLHDLVASREVESKGHVSQFDSRESHIPGDTPALRGGTPLLPRPALPCPGPPAGAMDTTVHLRSAMSAVAPMPEPTSEAPVSLAPTPAIPRPPRRVELRPAPPPRISAAPASARRGKLNPTPARAEDIRSPLARMVDEWPTLPRPRPAEPPLSPSRAAGSQRPYNMAAGTEEVDHSLPSREEMVACISRAVAVEVGKHFASLEKILRSSNGSGDCVPAPTNAAVPRGQAARPTSTPTSSTRLARRGGRNQNNRGTGAQNPALKSQPRPLPPPPSSMDEGWTEVVKRGKKGRQQTEALAAPRGGRALTAAARSTELVAVAAPRESRAPATNKKQNAKKKKTRAARSAAVVVTLLPAAAEKGLTYNEVMAQARAAVNLAEIGAEEGLRFRHTANGAKLLECPGADSSGVADRLVATLRVALPENEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSMGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSLVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGVNTERNRRRKSRRRQKRRLARGALANVAIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDATIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLDGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANVAGLYLVNRGSVATCVRWQGESVVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEDEARWFRDTMRRICDVSMPRISPRPPNRQVYWWSPEIAQLRVECVRARRQCARHRRRRLPRRNDPVAFAVVEAQLYGAFRVAQRALQLAIRRAKDQHMESLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEQGGFVAPAMGAPPEYDGDAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGCRPIVLLDEVGKLLERILAARIIQHLIGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHDGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVGAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDRVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVARPSPSVVRARRAQSRRSVLEAWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGSDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLALALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.70396e-11,     Score=174

Ontologies

Topology

Length:
1904
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.44076
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00007
outside
1  -  1904
 
 

Population Genetic Test Statistics

Pi
1.653361
Theta
1.913126
Tajima's D
0
CLR
115.612988
CSRT
0.414029298535073
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号