SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12506
Pre Gene Modal
BGIBMGA009389
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.049
 

Sequence

CDS
ATGGCTGGAAGTTACATTGTCAACGTGCCTAAATTGAAAGGTCGCGAAAACTTCGACGAGTGGGCGTTTGCAGCTGAACATTTTTTGATGTTGGAAGGTGTCGATATTCATAAGTTAGAATCGTCAACCGATGCTAGTTCTATTGATGAAAGAAAAGCTAAAGCTAAACTTATTATGACAATTGACTCTTCAATTTATGTTCACATTAAAAACGAGCAAACAGTACAAGGTGTGTGGAAGCGTTTAAAAGCCCTGTACGATGACTGTGGCTTTACGCGTCGCATCAGTCTACTTCGTCAGCTAATATCAATTCGATTAGAAGACAGCGAATCAATGGAAGCATATGTAACGCAAATGGTCGACACTGCACAAAAACTTAAAGGTACGGGTTTTCAGATCACTGATGAGTGGATCGGTTCACTATTATTAGCGGGCCTAACAGATACATTTGCTCCTATGATAATGGCCATTGAACATTCTGGATTAGCCATCAGTACGGATGCCATCAAGTCAAAATTACTGGACATGAGTTCAGAAGTTGGCAACACTGCAACTAACAATGCCTTTTTGTCGAAAGGTTGGCAGCACCGGAACAAGAAAAAAGGACTCAGGCGCAAGCTCACATATGATAACAGAAAAGAGTTGCTTACAGAATGTTTCCTATAA
Protein
MAGSYIVNVPKLKGRENFDEWAFAAEHFLMLEGVDIHKLESSTDASSIDERKAKAKLIMTIDSSIYVHIKNEQTVQGVWKRLKALYDDCGFTRRISLLRQLISIRLEDSESMEAYVTQMVDTAQKLKGTGFQITDEWIGSLLLAGLTDTFAPMIMAIEHSGLAISTDAIKSKLLDMSSEVGNTATNNAFLSKGWQHRNKKKGLRRKLTYDNRKELLTECFL

Summary

EMBL
ODYU01013273    SOQ59980.1    ODYU01010175    SOQ55116.1    AGBW02009826    OWR49812.1    + More
ODYU01011515    SOQ57290.1    GEZM01011859    GEZM01011855    JAV93394.1    GDQN01004560    JAT86494.1    ODYU01000075    SOQ34223.1    GEZM01011858    GEZM01011854    JAV93389.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    ODYU01012902    SOQ59440.1    GBHO01007564    JAG36040.1    NWSH01000816    PCG74073.1    QOIP01000004    RLU23300.1    GANO01000510    JAB59361.1    GDUN01000078    JAN95841.1    LBMM01012652    KMQ86076.1    GDQN01004734    JAT86320.1    NWSH01002292    PCG68657.1    PCG68658.1    KQ459875    KPJ19636.1    LBMM01019247    KMQ83577.1    JXUM01099713    KQ564513    KXJ72145.1    GBHO01029844    JAG13760.1    BABH01019436    GEDC01002834    JAS34464.1    GEZM01045162    JAV77889.1    LBMM01016836    KMQ84297.1    QOIP01000011    RLU16434.1    GBHO01042434    JAG01170.1    GANO01000659    JAB59212.1    LBMM01004924    KMQ91985.1    GANO01000660    JAB59211.1    ODYU01002507    SOQ40093.1    GBHO01011901    JAG31703.1    GBHO01026223    JAG17381.1    LBMM01020445    KMQ83285.1    GBHO01026221    JAG17383.1    GFTR01004319    JAW12107.1    LBMM01010129    KMQ87655.1    GBHO01001742    JAG41862.1    GBHO01001741    JAG41863.1    LBMM01010768    KMQ87255.1    KK107132    EZA58140.1    KQ460297    KPJ16236.1    GFTR01008662    JAW07764.1    LBMM01010791    KMQ87231.1    GBXI01011094    JAD03198.1    GBHO01007463    JAG36141.1    KK107871    EZA47378.1    LBMM01006235    KMQ90788.1    LBMM01010958    KMQ87117.1    GBHO01016596    JAG27008.1    GAKP01023107    JAC35849.1    GBHO01020706    JAG22898.1    GBHO01033237    JAG10367.1    GBHO01033235    JAG10369.1    GBHO01038507    JAG05097.1    GBHO01038505    JAG05099.1    NWSH01000234    PCG78150.1    GBHO01020974    JAG22630.1    KZ149913    PZC78057.1    RSAL01000063    RVE49487.1    GEZM01044588    JAV78134.1    LBMM01009660    KMQ87962.1    GEHC01000868    JAV46777.1    GEHC01000867    JAV46778.1    LBMM01011462    KMQ86820.1    JTDY01010240    KOB59525.1    GAKP01015352    JAC43600.1    JTDY01000892    KOB75534.1    LBMM01013295    KMQ85718.1    GEHC01000989    JAV46656.1    GEHC01000988    JAV46657.1    ODYU01009608    SOQ54162.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    QOIP01000003    RLU25147.1    KQ978269    KYM95809.1    GBHO01036544    JAG07060.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF16682   MSL2-CXC
PF17906   HTH_48
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR012337   RNaseH-like_sf       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR032049   Msl2-CXC       
IPR033467   Tesmin/TSO1-like_CXC       
IPR037922   MSL2       
IPR041426   Mos1_HTH       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
221
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.2592
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.05072
outside
1  -  221
 
 

Population Genetic Test Statistics

Pi
47.417552
Theta
55.64954
Tajima's D
-0.415899
CLR
3.289916
CSRT
0.263986800659967
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号