SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12502
Annotation
PREDICTED:_uncharacterized_protein_LOC106713896?_partial_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 2.771
 

Sequence

CDS
ATGCTTAGTCTATCCGGTGTGCGGCTGTCGGCTGTAGAAGACCGAATAAAGGTGAATCGGGGTATATTTCAGGGTGATTGTCTGAGTCCATTGTGGTTTTGCCTGGCCCTGAATCCTCTCAGTTCATTACTGGAGGCTTCGAGGACAGGCTTTCAGTTCCGAAGGGGGGGCTTGAAGGTGTCCCACTTGTTCTACATGGATGACCTCAAGTTGTACGCTCCTCATGCTGCAGGCCTCAGGCGACTGCTTGACATCACTTGTGATTTCAGTAGTCGCATTAGGATGAGGCTGGGAGTCGACAAGTGTGCGGTTCTCCATGTAGAGAGAGGGAGCATAGTCTCATCGGATCGTTTACCTGTATCCGATGGGATAAACCTTCGGGCACTCTCCGAGGGAGAAACATACCGGTACCTGGGCATGTCGCAAAATTTAGGTATTGACGTGGCGGTCGTCAAACAGGCTGCATGCGACGTGTTTTATGAACGTTTGACAAAAGTGTGTAAGAGCCTTTTGTCGGGCGTGAATAAGACAAGGGCGTTTAACGGCTGGGTGATGCCCGTCCTGTTGTATACCTTCGGCGTGCTCAGGTGGACTCAGACCGAACTGGATGCCCTGGATAGAAAAGTCCGCTCAATTATGACCCTCCATAGGATGCTTCACCCGAAGTCCTCGGTAATGAGATTGTACATTCCGCGGAAGTGTGGTGGCCGGGGCCTACTTAGCGCCAAGGTCATGCACAACAGTGGGGTGTGCAGTCTCAGGGAATATTTCCTATCGAGGGCTGACAGTGTGATGCACAGAGAGGTCATGGAATGCGACAAAGGACTGACCCCACTAGCCCTGGCCAGAGACGGGTGGCAATCACCGGCGGTACTCAGTACCTCTGACCGTGAGGCCATATGGAAAGGGAAAGAGCTGCACGGACGCTTCTTTCAGGCACTGCATGAGCCCCACGTGGACAAAGAAGCCTCCGTGCACTGGCTGCGATTCGGTGACCTCTTTGGGGAAACTGAGGGTTTTGTCTGTGCAATACAGGATCAGGTTATCAGGACGAACAACTATAGGAAGCACATTCTGAGGGATGGGACAGCTGACATCTGTCGATTATGCCGCCGACCGGGTGAATCCCTCAGACATGTCACCTCTGGTTGTCCTATGCTTGCTAACACTGAGTACTTGCACAGGCATAACCAAGCAGCAAGAATCCTCCACCAAGAGCTCGCCCTTAAGTATGGCCTCATCGAACAGAGGCTACCGTATTATAAGTACCAGCCGGACGCTGTACTCGAAAACGACCGTGCCAAGCTCTACTGGGACCGGCCCATCATTACGGACAGGACTATTCTTGCTAATAAGCCTGATATCGTGCTGATGGACCGGATGGAGTCTCGGGTATTTCTGGTGGATATCACCATCCCCTACGACGAGAACCTCGTGCGGGCCGAGGCAGATAAAAAGACCAAATATTTGGACCTGGCGCACGAGGTGACCGACATGTGGAGGGTGGTATCTACAGAAATAATCCCGGTAGTTGTGTCGGTGAATGGTTTGGTCCCTAAAAGCCTCTCAAAACATCTCGAGAGGCTTGGTCTCAACAAAAAGTCGGTGGTGGCACAAATGCAAAAAGCAGTCTTGCTCGACAATGCCCGTATAGTTCGCCGGTTTCTCTCCCAATAG
Protein
MLSLSGVRLSAVEDRIKVNRGIFQGDCLSPLWFCLALNPLSSLLEASRTGFQFRRGGLKVSHLFYMDDLKLYAPHAAGLRRLLDITCDFSSRIRMRLGVDKCAVLHVERGSIVSSDRLPVSDGINLRALSEGETYRYLGMSQNLGIDVAVVKQAACDVFYERLTKVCKSLLSGVNKTRAFNGWVMPVLLYTFGVLRWTQTELDALDRKVRSIMTLHRMLHPKSSVMRLYIPRKCGGRGLLSAKVMHNSGVCSLREYFLSRADSVMHREVMECDKGLTPLALARDGWQSPAVLSTSDREAIWKGKELHGRFFQALHEPHVDKEASVHWLRFGDLFGETEGFVCAIQDQVIRTNNYRKHILRDGTADICRLCRRPGESLRHVTSGCPMLANTEYLHRHNQAARILHQELALKYGLIEQRLPYYKYQPDAVLENDRAKLYWDRPIITDRTILANKPDIVLMDRMESRVFLVDITIPYDENLVRAEADKKTKYLDLAHEVTDMWRVVSTEIIPVVVSVNGLVPKSLSKHLERLGLNKKSVVAQMQKAVLLDNARIVRRFLSQ

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       

Ontologies

Topology

Length:
558
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.29609
Exp number, first 60 AAs:
0.09257
Total prob of N-in:
0.00939
outside
1  -  558
 
 

Population Genetic Test Statistics

Pi
139.127494
Theta
76.994289
Tajima's D
2.263615
CLR
12.449845
CSRT
0.91620418979051
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号